Multiple sequence alignment - TraesCS4D01G140400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G140400 chr4D 100.000 2369 0 0 1 2369 123719143 123721511 0 4375
1 TraesCS4D01G140400 chr4D 95.527 2370 72 22 1 2369 241165331 241167667 0 3759
2 TraesCS4D01G140400 chr7D 98.820 2372 25 2 1 2369 203518115 203520486 0 4222
3 TraesCS4D01G140400 chr1B 98.104 2373 41 3 1 2369 638698027 638695655 0 4130
4 TraesCS4D01G140400 chr1B 97.766 2372 46 6 1 2369 672481796 672484163 0 4080
5 TraesCS4D01G140400 chr1B 95.288 2377 101 7 1 2369 377806704 377809077 0 3759
6 TraesCS4D01G140400 chr4B 97.680 2371 53 1 1 2369 209074882 209072512 0 4072
7 TraesCS4D01G140400 chr4B 97.554 2371 55 2 1 2369 159074795 159077164 0 4054
8 TraesCS4D01G140400 chr3D 97.680 2371 51 3 1 2369 501931170 501928802 0 4071
9 TraesCS4D01G140400 chr1A 96.716 2375 69 5 1 2369 415667204 415669575 0 3945


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G140400 chr4D 123719143 123721511 2368 False 4375 4375 100.000 1 2369 1 chr4D.!!$F1 2368
1 TraesCS4D01G140400 chr4D 241165331 241167667 2336 False 3759 3759 95.527 1 2369 1 chr4D.!!$F2 2368
2 TraesCS4D01G140400 chr7D 203518115 203520486 2371 False 4222 4222 98.820 1 2369 1 chr7D.!!$F1 2368
3 TraesCS4D01G140400 chr1B 638695655 638698027 2372 True 4130 4130 98.104 1 2369 1 chr1B.!!$R1 2368
4 TraesCS4D01G140400 chr1B 672481796 672484163 2367 False 4080 4080 97.766 1 2369 1 chr1B.!!$F2 2368
5 TraesCS4D01G140400 chr1B 377806704 377809077 2373 False 3759 3759 95.288 1 2369 1 chr1B.!!$F1 2368
6 TraesCS4D01G140400 chr4B 209072512 209074882 2370 True 4072 4072 97.680 1 2369 1 chr4B.!!$R1 2368
7 TraesCS4D01G140400 chr4B 159074795 159077164 2369 False 4054 4054 97.554 1 2369 1 chr4B.!!$F1 2368
8 TraesCS4D01G140400 chr3D 501928802 501931170 2368 True 4071 4071 97.680 1 2369 1 chr3D.!!$R1 2368
9 TraesCS4D01G140400 chr1A 415667204 415669575 2371 False 3945 3945 96.716 1 2369 1 chr1A.!!$F1 2368

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
521 530 0.740737 CGTTGGGGATTCATTGCTCC 59.259 55.0 0.0 0.0 0.0 4.7 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1704 1721 2.160721 TTTTGTTGGCAACCCCTGTA 57.839 45.0 26.31 4.79 33.82 2.74 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
110 111 2.056577 CTCACGTACGGTTCCTTTGAC 58.943 52.381 21.06 0.0 0.00 3.18
521 530 0.740737 CGTTGGGGATTCATTGCTCC 59.259 55.000 0.00 0.0 0.00 4.70
561 570 3.705072 ACGTAGCCAGCCTAATTTCTAGT 59.295 43.478 0.00 0.0 0.00 2.57
688 697 2.865551 CGTGTACAACAACCTTAACCGT 59.134 45.455 0.00 0.0 0.00 4.83
775 784 1.234615 TTTGAAGCCGAGCCTTTCCG 61.235 55.000 0.00 0.0 0.00 4.30
855 864 2.912690 GGCACCTGTAGGGATTAGTC 57.087 55.000 2.53 0.0 40.27 2.59
1704 1721 5.484998 AGCCTCCCAAATCAAACATACATTT 59.515 36.000 0.00 0.0 0.00 2.32
2063 2080 3.242739 CCGTTTTATTCGCTGCTTGCTAT 60.243 43.478 0.00 0.0 40.11 2.97
2348 2368 3.683340 CCCGCTACTGTAAAAAGAACTCC 59.317 47.826 0.00 0.0 0.00 3.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
490 495 0.306533 CCCCAACGACAAACGAACAG 59.693 55.000 0.00 0.00 45.77 3.16
521 530 6.474751 GGCTACGTTACTTATAACCACAGAAG 59.525 42.308 0.00 0.00 37.94 2.85
561 570 3.241530 CCTGCCCGCAGCCCTATA 61.242 66.667 11.29 0.00 42.35 1.31
640 649 4.284490 TCAGTTGAGCATTCAGTTAGAGGT 59.716 41.667 0.00 0.00 34.15 3.85
729 738 0.394565 GTGGAGCTTCCGCCTCATAT 59.605 55.000 0.00 0.00 41.08 1.78
855 864 1.153823 GTGGATCACGGTCTCACGG 60.154 63.158 0.00 0.00 38.39 4.94
866 875 1.805943 CATGCGTCAGTTTGTGGATCA 59.194 47.619 0.00 0.00 0.00 2.92
1704 1721 2.160721 TTTTGTTGGCAACCCCTGTA 57.839 45.000 26.31 4.79 33.82 2.74


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.