Multiple sequence alignment - TraesCS4D01G140300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G140300 chr4D 100.000 2230 0 0 834 3063 123717423 123719652 0 4119
1 TraesCS4D01G140300 chr4D 98.882 2236 19 4 834 3063 123300803 123303038 0 3986
2 TraesCS4D01G140300 chr4D 100.000 718 0 0 1 718 123716590 123717307 0 1327
3 TraesCS4D01G140300 chr4D 98.747 718 9 0 1 718 123300051 123300768 0 1277
4 TraesCS4D01G140300 chr7D 98.480 2237 27 5 834 3063 203516390 203518626 0 3936
5 TraesCS4D01G140300 chr7D 98.886 718 8 0 1 718 203515637 203516354 0 1282
6 TraesCS4D01G140300 chr7B 98.479 2236 28 4 834 3063 644468356 644470591 0 3936
7 TraesCS4D01G140300 chr7B 98.886 718 8 0 1 718 644467605 644468322 0 1282
8 TraesCS4D01G140300 chr6B 98.166 2235 36 3 834 3063 306995074 306992840 0 3895
9 TraesCS4D01G140300 chr1B 98.166 2235 35 4 834 3063 638699749 638697516 0 3895
10 TraesCS4D01G140300 chr1B 98.609 719 9 1 1 718 638700506 638699788 0 1271
11 TraesCS4D01G140300 chr3A 98.166 2235 34 5 834 3063 633112166 633114398 0 3893
12 TraesCS4D01G140300 chr3A 98.607 718 10 0 1 718 633111415 633112132 0 1271
13 TraesCS4D01G140300 chr7A 97.897 2235 41 4 834 3063 46396029 46393796 0 3862
14 TraesCS4D01G140300 chr7A 98.329 718 12 0 1 718 211275050 211274333 0 1260
15 TraesCS4D01G140300 chr2B 97.718 2235 46 3 834 3063 391111926 391109692 0 3840
16 TraesCS4D01G140300 chr2A 97.719 2236 42 6 834 3063 332943384 332941152 0 3838
17 TraesCS4D01G140300 chrUn 98.886 718 8 0 1 718 36546024 36546741 0 1282
18 TraesCS4D01G140300 chrUn 98.886 718 8 0 1 718 275330101 275329384 0 1282
19 TraesCS4D01G140300 chr1D 98.886 718 8 0 1 718 141312975 141312258 0 1282


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G140300 chr4D 123716590 123719652 3062 False 2723.0 4119 100.0000 1 3063 2 chr4D.!!$F2 3062
1 TraesCS4D01G140300 chr4D 123300051 123303038 2987 False 2631.5 3986 98.8145 1 3063 2 chr4D.!!$F1 3062
2 TraesCS4D01G140300 chr7D 203515637 203518626 2989 False 2609.0 3936 98.6830 1 3063 2 chr7D.!!$F1 3062
3 TraesCS4D01G140300 chr7B 644467605 644470591 2986 False 2609.0 3936 98.6825 1 3063 2 chr7B.!!$F1 3062
4 TraesCS4D01G140300 chr6B 306992840 306995074 2234 True 3895.0 3895 98.1660 834 3063 1 chr6B.!!$R1 2229
5 TraesCS4D01G140300 chr1B 638697516 638700506 2990 True 2583.0 3895 98.3875 1 3063 2 chr1B.!!$R1 3062
6 TraesCS4D01G140300 chr3A 633111415 633114398 2983 False 2582.0 3893 98.3865 1 3063 2 chr3A.!!$F1 3062
7 TraesCS4D01G140300 chr7A 46393796 46396029 2233 True 3862.0 3862 97.8970 834 3063 1 chr7A.!!$R1 2229
8 TraesCS4D01G140300 chr7A 211274333 211275050 717 True 1260.0 1260 98.3290 1 718 1 chr7A.!!$R2 717
9 TraesCS4D01G140300 chr2B 391109692 391111926 2234 True 3840.0 3840 97.7180 834 3063 1 chr2B.!!$R1 2229
10 TraesCS4D01G140300 chr2A 332941152 332943384 2232 True 3838.0 3838 97.7190 834 3063 1 chr2A.!!$R1 2229
11 TraesCS4D01G140300 chrUn 36546024 36546741 717 False 1282.0 1282 98.8860 1 718 1 chrUn.!!$F1 717
12 TraesCS4D01G140300 chrUn 275329384 275330101 717 True 1282.0 1282 98.8860 1 718 1 chrUn.!!$R1 717
13 TraesCS4D01G140300 chr1D 141312258 141312975 717 True 1282.0 1282 98.8860 1 718 1 chr1D.!!$R1 717

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
548 550 0.798776 CGGCAGAAGCACGAAATTCT 59.201 50.0 0.00 0.0 44.61 2.40 F
910 913 1.084370 CCTTAACAAGCCCTCGAGCG 61.084 60.0 6.99 0.0 38.01 5.03 F
1437 1442 0.179009 CACTCCGCCATCCATTCCAT 60.179 55.0 0.00 0.0 0.00 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1419 1424 0.179009 CATGGAATGGATGGCGGAGT 60.179 55.000 0.0 0.0 41.79 3.85 R
1711 1716 3.069729 CCTTCCGACCAAAGGGAGTATAG 59.930 52.174 0.0 0.0 39.75 1.31 R
3043 3056 0.306533 CCCCAACGACAAACGAACAG 59.693 55.000 0.0 0.0 45.77 3.16 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
148 150 4.097437 CGCTCACAGTAGTTCTACCCATAA 59.903 45.833 6.39 0.0 0.00 1.90
219 221 1.001974 CCCGAGTTTCCAGACACATCA 59.998 52.381 0.00 0.0 0.00 3.07
499 501 5.281314 CCCTACCAGGCAATATCTACCTAT 58.719 45.833 0.00 0.0 32.73 2.57
548 550 0.798776 CGGCAGAAGCACGAAATTCT 59.201 50.000 0.00 0.0 44.61 2.40
625 627 8.299990 TGACCAAGAAAAGTATGGAAAAGAAA 57.700 30.769 0.00 0.0 37.66 2.52
910 913 1.084370 CCTTAACAAGCCCTCGAGCG 61.084 60.000 6.99 0.0 38.01 5.03
1281 1286 2.632377 CGCAGGATCAACAACCATAGT 58.368 47.619 0.00 0.0 0.00 2.12
1354 1359 3.317149 CGAGGACGACTCCCATACAATTA 59.683 47.826 0.00 0.0 43.57 1.40
1359 1364 4.776349 ACGACTCCCATACAATTATTGCA 58.224 39.130 4.68 0.0 0.00 4.08
1419 1424 1.285280 ATAACTGCCTGCCACCTACA 58.715 50.000 0.00 0.0 0.00 2.74
1437 1442 0.179009 CACTCCGCCATCCATTCCAT 60.179 55.000 0.00 0.0 0.00 3.41
1711 1716 6.622462 GCATGAGTGTCCTGAAGAAGAAATTC 60.622 42.308 0.00 0.0 0.00 2.17
2465 2475 6.403200 GCTTACGCATCAGAAAAATAGAACCA 60.403 38.462 0.00 0.0 35.78 3.67
2663 2674 2.056577 CTCACGTACGGTTCCTTTGAC 58.943 52.381 21.06 0.0 0.00 3.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
148 150 5.649395 TGATCGCCTCTTTCATGATCTTTTT 59.351 36.000 0.00 0.00 37.07 1.94
219 221 4.052229 CGACCCGAGCGGAAGTGT 62.052 66.667 11.05 0.00 37.50 3.55
424 426 1.386057 GGCCCTTCTCACCCCCTAT 60.386 63.158 0.00 0.00 0.00 2.57
499 501 4.075682 CCTATCTCCTGATCGAGCTTGTA 58.924 47.826 0.90 0.00 34.32 2.41
548 550 8.842358 AACCGATCTTATTTTCACTACAAGAA 57.158 30.769 0.00 0.00 0.00 2.52
910 913 4.103103 GAAGGCGGCGCAAAGGAC 62.103 66.667 34.36 15.07 0.00 3.85
1147 1152 1.945394 AGTAAGTCGTCGGCATATCGT 59.055 47.619 0.00 0.00 0.00 3.73
1281 1286 1.246649 TTCTACCGTACTCCGTGCAA 58.753 50.000 0.00 0.00 33.66 4.08
1354 1359 1.461559 GCTTCTCCAGCTCTTGCAAT 58.538 50.000 0.00 0.00 46.27 3.56
1419 1424 0.179009 CATGGAATGGATGGCGGAGT 60.179 55.000 0.00 0.00 41.79 3.85
1437 1442 7.952368 GGATACTATAACCTAGGTCCCTAAACA 59.048 40.741 16.64 0.00 0.00 2.83
1515 1520 1.544691 GAGTCTCCGCTAGTTGAACCA 59.455 52.381 0.00 0.00 0.00 3.67
1711 1716 3.069729 CCTTCCGACCAAAGGGAGTATAG 59.930 52.174 0.00 0.00 39.75 1.31
2448 2458 5.067805 GCCGGAATGGTTCTATTTTTCTGAT 59.932 40.000 5.05 0.00 41.21 2.90
2838 2851 7.432148 TGCACGGACCCATATATATAGAAAT 57.568 36.000 0.00 0.00 0.00 2.17
3043 3056 0.306533 CCCCAACGACAAACGAACAG 59.693 55.000 0.00 0.00 45.77 3.16


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.