Multiple sequence alignment - TraesCS4D01G140200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G140200 chr4D 100.000 2255 0 0 1 2255 123714613 123716867 0 4165
1 TraesCS4D01G140200 chr4D 97.946 633 8 4 1 630 123707583 123708213 0 1092
2 TraesCS4D01G140200 chr4D 97.161 634 12 4 1 630 69636321 69636952 0 1066
3 TraesCS4D01G140200 chr4D 97.152 632 15 3 1 630 403380216 403380846 0 1064
4 TraesCS4D01G140200 chr1D 99.200 1625 12 1 631 2255 141314321 141312698 0 2928
5 TraesCS4D01G140200 chr1D 97.003 634 14 4 1 630 386717340 386717972 0 1061
6 TraesCS4D01G140200 chr2B 99.138 1625 13 1 631 2255 799246786 799248409 0 2922
7 TraesCS4D01G140200 chr7B 99.077 1626 14 1 631 2255 644466257 644467882 0 2918
8 TraesCS4D01G140200 chrUn 99.015 1625 16 0 631 2255 225927067 225928691 0 2913
9 TraesCS4D01G140200 chrUn 97.161 634 12 4 1 630 340971383 340970752 0 1066
10 TraesCS4D01G140200 chr3A 98.954 1625 17 0 631 2255 633110068 633111692 0 2907
11 TraesCS4D01G140200 chr1B 98.831 1626 17 2 631 2255 638701852 638700228 0 2896
12 TraesCS4D01G140200 chr1B 98.708 1625 21 0 631 2255 672477975 672479599 0 2885
13 TraesCS4D01G140200 chr7A 98.769 1625 20 0 631 2255 60149473 60147849 0 2891
14 TraesCS4D01G140200 chr6B 98.400 1625 26 0 631 2255 306997176 306995552 0 2857
15 TraesCS4D01G140200 chr7D 97.464 631 14 2 1 630 510320888 510321517 0 1075
16 TraesCS4D01G140200 chr5D 97.464 631 15 1 1 630 519194293 519194923 0 1075
17 TraesCS4D01G140200 chr2D 97.147 631 16 2 1 630 617746384 617745755 0 1064
18 TraesCS4D01G140200 chr6D 96.417 642 18 5 1 641 47820412 47819775 0 1053


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G140200 chr4D 123714613 123716867 2254 False 4165 4165 100.000 1 2255 1 chr4D.!!$F3 2254
1 TraesCS4D01G140200 chr4D 123707583 123708213 630 False 1092 1092 97.946 1 630 1 chr4D.!!$F2 629
2 TraesCS4D01G140200 chr4D 69636321 69636952 631 False 1066 1066 97.161 1 630 1 chr4D.!!$F1 629
3 TraesCS4D01G140200 chr4D 403380216 403380846 630 False 1064 1064 97.152 1 630 1 chr4D.!!$F4 629
4 TraesCS4D01G140200 chr1D 141312698 141314321 1623 True 2928 2928 99.200 631 2255 1 chr1D.!!$R1 1624
5 TraesCS4D01G140200 chr1D 386717340 386717972 632 False 1061 1061 97.003 1 630 1 chr1D.!!$F1 629
6 TraesCS4D01G140200 chr2B 799246786 799248409 1623 False 2922 2922 99.138 631 2255 1 chr2B.!!$F1 1624
7 TraesCS4D01G140200 chr7B 644466257 644467882 1625 False 2918 2918 99.077 631 2255 1 chr7B.!!$F1 1624
8 TraesCS4D01G140200 chrUn 225927067 225928691 1624 False 2913 2913 99.015 631 2255 1 chrUn.!!$F1 1624
9 TraesCS4D01G140200 chrUn 340970752 340971383 631 True 1066 1066 97.161 1 630 1 chrUn.!!$R1 629
10 TraesCS4D01G140200 chr3A 633110068 633111692 1624 False 2907 2907 98.954 631 2255 1 chr3A.!!$F1 1624
11 TraesCS4D01G140200 chr1B 638700228 638701852 1624 True 2896 2896 98.831 631 2255 1 chr1B.!!$R1 1624
12 TraesCS4D01G140200 chr1B 672477975 672479599 1624 False 2885 2885 98.708 631 2255 1 chr1B.!!$F1 1624
13 TraesCS4D01G140200 chr7A 60147849 60149473 1624 True 2891 2891 98.769 631 2255 1 chr7A.!!$R1 1624
14 TraesCS4D01G140200 chr6B 306995552 306997176 1624 True 2857 2857 98.400 631 2255 1 chr6B.!!$R1 1624
15 TraesCS4D01G140200 chr7D 510320888 510321517 629 False 1075 1075 97.464 1 630 1 chr7D.!!$F1 629
16 TraesCS4D01G140200 chr5D 519194293 519194923 630 False 1075 1075 97.464 1 630 1 chr5D.!!$F1 629
17 TraesCS4D01G140200 chr2D 617745755 617746384 629 True 1064 1064 97.147 1 630 1 chr2D.!!$R1 629
18 TraesCS4D01G140200 chr6D 47819775 47820412 637 True 1053 1053 96.417 1 641 1 chr6D.!!$R1 640

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
900 916 1.226773 GGATGATTGCCGCTTGTGC 60.227 57.895 0.0 0.0 0.0 4.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1953 1969 3.147595 CATCACTCTCGGGCCCGA 61.148 66.667 42.62 42.62 46.87 5.14 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
315 328 3.394836 GAAGCCCTGCCGAGACCT 61.395 66.667 0.00 0.00 0.00 3.85
373 387 1.407437 CCATCAACCTCTCCTTTCCCG 60.407 57.143 0.00 0.00 0.00 5.14
424 438 1.279152 CACCGTACGTGTGTTGAACA 58.721 50.000 21.45 0.00 37.73 3.18
631 646 7.658525 AAATTATGCTATGATTCCCAACACA 57.341 32.000 0.00 0.00 0.00 3.72
632 647 7.658525 AATTATGCTATGATTCCCAACACAA 57.341 32.000 0.00 0.00 0.00 3.33
633 648 7.844493 ATTATGCTATGATTCCCAACACAAT 57.156 32.000 0.00 0.00 0.00 2.71
900 916 1.226773 GGATGATTGCCGCTTGTGC 60.227 57.895 0.00 0.00 0.00 4.57
993 1009 1.324740 ACTCCGCGGTGCTGGTTATA 61.325 55.000 27.15 0.00 0.00 0.98
1598 1614 2.362397 TCTGGGATCAGTGATAGTTCGC 59.638 50.000 5.38 3.62 41.59 4.70
1953 1969 1.456287 GCCTCCTCTTGGTTGGTGT 59.544 57.895 0.00 0.00 33.23 4.16
2125 2142 4.097437 CGCTCACAGTAGTTCTACCCATAA 59.903 45.833 6.39 0.00 0.00 1.90
2196 2213 1.001974 CCCGAGTTTCCAGACACATCA 59.998 52.381 0.00 0.00 0.00 3.07
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
260 273 0.617820 GGAGAGGTGTAGCAGGGGAA 60.618 60.000 0.00 0.00 0.00 3.97
315 328 1.295101 CGTGGTGGTGGATGTAGCA 59.705 57.895 0.00 0.00 0.00 3.49
373 387 2.026822 TCCTCCTTCTTGATCCAGCAAC 60.027 50.000 0.00 0.00 0.00 4.17
900 916 2.415893 GGACCCACAGCAATGAAATTCG 60.416 50.000 0.00 0.00 31.22 3.34
1114 1130 8.705134 GCCATTACAAAAACAAGGTATAACAAC 58.295 33.333 0.00 0.00 0.00 3.32
1115 1131 7.873505 GGCCATTACAAAAACAAGGTATAACAA 59.126 33.333 0.00 0.00 0.00 2.83
1598 1614 1.228675 AGCCTCCCTTTGCTGGTTG 60.229 57.895 0.00 0.00 36.23 3.77
1953 1969 3.147595 CATCACTCTCGGGCCCGA 61.148 66.667 42.62 42.62 46.87 5.14
2125 2142 5.649395 TGATCGCCTCTTTCATGATCTTTTT 59.351 36.000 0.00 0.00 37.07 1.94
2196 2213 4.052229 CGACCCGAGCGGAAGTGT 62.052 66.667 11.05 0.00 37.50 3.55


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.