Multiple sequence alignment - TraesCS4D01G140100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G140100 chr4D 100.000 2342 0 0 1 2342 123689167 123691508 0 4325
1 TraesCS4D01G140100 chrUn 99.018 2342 23 0 1 2342 257944317 257946658 0 4198
2 TraesCS4D01G140100 chrUn 98.762 2342 24 1 1 2342 233525063 233522727 0 4159
3 TraesCS4D01G140100 chr1D 98.933 2342 25 0 1 2342 212429074 212431415 0 4187
4 TraesCS4D01G140100 chr2D 98.463 2342 34 2 1 2342 637308500 637306161 0 4124
5 TraesCS4D01G140100 chr7B 98.463 2342 30 2 1 2342 698126728 698124393 0 4120
6 TraesCS4D01G140100 chr7B 98.079 2342 40 1 1 2342 716795633 716793297 0 4071
7 TraesCS4D01G140100 chr7A 98.420 2342 32 1 1 2342 60095993 60093657 0 4115
8 TraesCS4D01G140100 chr7A 98.036 2342 46 0 1 2342 211237929 211235588 0 4071
9 TraesCS4D01G140100 chr6B 98.076 2339 40 1 4 2342 128889775 128887442 0 4065


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G140100 chr4D 123689167 123691508 2341 False 4325 4325 100.000 1 2342 1 chr4D.!!$F1 2341
1 TraesCS4D01G140100 chrUn 257944317 257946658 2341 False 4198 4198 99.018 1 2342 1 chrUn.!!$F1 2341
2 TraesCS4D01G140100 chrUn 233522727 233525063 2336 True 4159 4159 98.762 1 2342 1 chrUn.!!$R1 2341
3 TraesCS4D01G140100 chr1D 212429074 212431415 2341 False 4187 4187 98.933 1 2342 1 chr1D.!!$F1 2341
4 TraesCS4D01G140100 chr2D 637306161 637308500 2339 True 4124 4124 98.463 1 2342 1 chr2D.!!$R1 2341
5 TraesCS4D01G140100 chr7B 698124393 698126728 2335 True 4120 4120 98.463 1 2342 1 chr7B.!!$R1 2341
6 TraesCS4D01G140100 chr7B 716793297 716795633 2336 True 4071 4071 98.079 1 2342 1 chr7B.!!$R2 2341
7 TraesCS4D01G140100 chr7A 60093657 60095993 2336 True 4115 4115 98.420 1 2342 1 chr7A.!!$R1 2341
8 TraesCS4D01G140100 chr7A 211235588 211237929 2341 True 4071 4071 98.036 1 2342 1 chr7A.!!$R2 2341
9 TraesCS4D01G140100 chr6B 128887442 128889775 2333 True 4065 4065 98.076 4 2342 1 chr6B.!!$R1 2338

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
705 706 0.530744 AACGCACGCTAGATGGAGAA 59.469 50.0 0.0 0.0 0.0 2.87 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1824 1826 1.838073 TTTCCTCTGCCGGGGACTTC 61.838 60.0 2.18 0.0 0.0 3.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
525 526 1.513158 GCGACAGCTTCTGCCTCTA 59.487 57.895 0.00 0.0 40.80 2.43
581 582 2.813172 GTCTCTATGTAGTAGTCGGCCC 59.187 54.545 0.00 0.0 0.00 5.80
705 706 0.530744 AACGCACGCTAGATGGAGAA 59.469 50.000 0.00 0.0 0.00 2.87
742 743 4.244066 TGCTTGCATTGCATTCGTTAAAT 58.756 34.783 12.95 0.0 38.76 1.40
764 765 4.157120 GCTTCCGCGCCCTTCCTA 62.157 66.667 0.00 0.0 0.00 2.94
957 958 1.306642 AAGATGTCTCCGACGCGACT 61.307 55.000 15.93 0.0 34.95 4.18
1390 1391 0.745845 GCAGCATGAGGAATGTCCGT 60.746 55.000 0.00 0.0 39.69 4.69
1396 1397 1.627864 TGAGGAATGTCCGTGTCTCA 58.372 50.000 0.00 0.0 42.75 3.27
1407 1408 0.179137 CGTGTCTCATCGCAAGGCTA 60.179 55.000 0.00 0.0 38.47 3.93
1430 1431 7.093945 GCTAATTTTGAGTTTTGGGTCATAGGA 60.094 37.037 0.00 0.0 0.00 2.94
1683 1684 5.790593 AGAAAATAACAGACTAAGCCGTGA 58.209 37.500 0.00 0.0 0.00 4.35
1824 1826 0.727793 CGCCCGTTTTCATTTCGTGG 60.728 55.000 0.00 0.0 0.00 4.94
1907 1909 0.104120 CGTTCCTATGGGATCGTGCA 59.896 55.000 17.76 0.0 44.93 4.57
1980 1982 6.471146 CCTATTCTCATAATAGGCAGCAAGT 58.529 40.000 10.10 0.0 41.79 3.16
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
525 526 0.530744 TGAGCGATAGTGAAGCCGTT 59.469 50.000 0.00 0.00 39.35 4.44
605 606 0.461339 GGCATTCGGGAAGCGACTAA 60.461 55.000 0.00 0.00 0.00 2.24
764 765 4.768448 TCATTCACATCAATTGAAGCAGGT 59.232 37.500 13.09 3.49 36.44 4.00
957 958 7.147373 CCCCTATAAAAATCTAGTGGAAGTCCA 60.147 40.741 0.00 0.00 45.30 4.02
1390 1391 2.988010 ATTAGCCTTGCGATGAGACA 57.012 45.000 0.00 0.00 0.00 3.41
1396 1397 5.391312 AAACTCAAAATTAGCCTTGCGAT 57.609 34.783 0.00 0.00 0.00 4.58
1407 1408 6.294508 CGTCCTATGACCCAAAACTCAAAATT 60.295 38.462 0.00 0.00 38.32 1.82
1824 1826 1.838073 TTTCCTCTGCCGGGGACTTC 61.838 60.000 2.18 0.00 0.00 3.01
1907 1909 3.842436 TCATCATCTATACCAGCTGCCAT 59.158 43.478 8.66 5.84 0.00 4.40
1980 1982 4.687769 CGCCCCCTTTCCTATTTAGCTTTA 60.688 45.833 0.00 0.00 0.00 1.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.