Multiple sequence alignment - TraesCS4D01G140000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G140000 chr4D 100.000 2351 0 0 1 2351 123688070 123690420 0.000000e+00 4342.0
1 TraesCS4D01G140000 chrUn 99.192 2351 18 1 1 2351 257943221 257945570 0.000000e+00 4235.0
2 TraesCS4D01G140000 chrUn 98.937 2351 19 2 1 2351 233526159 233523815 0.000000e+00 4198.0
3 TraesCS4D01G140000 chr2D 98.596 2351 32 1 1 2351 637309596 637307247 0.000000e+00 4157.0
4 TraesCS4D01G140000 chr2D 98.342 2352 32 5 1 2351 306151996 306154341 0.000000e+00 4120.0
5 TraesCS4D01G140000 chr2D 97.872 47 1 0 1 47 235781819 235781773 5.390000e-12 82.4
6 TraesCS4D01G140000 chr6D 97.959 2352 46 2 1 2351 283186521 283188871 0.000000e+00 4076.0
7 TraesCS4D01G140000 chr7D 97.831 2351 48 3 1 2351 307088606 307090953 0.000000e+00 4056.0
8 TraesCS4D01G140000 chr4B 97.661 2351 48 3 1 2351 495538665 495536322 0.000000e+00 4030.0
9 TraesCS4D01G140000 chr2A 97.280 2353 61 3 1 2351 444302027 444304378 0.000000e+00 3988.0
10 TraesCS4D01G140000 chr2A 97.980 198 4 0 1806 2003 529359797 529359994 6.220000e-91 344.0
11 TraesCS4D01G140000 chr2A 83.680 337 27 11 1467 1799 572745509 572745821 2.290000e-75 292.0
12 TraesCS4D01G140000 chr2A 93.048 187 13 0 2165 2351 39446980 39447166 8.280000e-70 274.0
13 TraesCS4D01G140000 chr2A 87.931 174 17 4 147 319 511113609 511113439 3.960000e-48 202.0
14 TraesCS4D01G140000 chr2A 92.701 137 10 0 257 393 116444683 116444547 5.120000e-47 198.0
15 TraesCS4D01G140000 chr2A 91.473 129 10 1 412 540 5165233 5165360 2.400000e-40 176.0
16 TraesCS4D01G140000 chr2A 92.308 91 6 1 1721 1811 529241266 529241355 6.820000e-26 128.0
17 TraesCS4D01G140000 chr2A 91.892 74 0 1 912 985 65274534 65274601 5.350000e-17 99.0
18 TraesCS4D01G140000 chr2A 100.000 33 0 0 1191 1223 177383967 177383935 7.020000e-06 62.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G140000 chr4D 123688070 123690420 2350 False 4342 4342 100.000 1 2351 1 chr4D.!!$F1 2350
1 TraesCS4D01G140000 chrUn 257943221 257945570 2349 False 4235 4235 99.192 1 2351 1 chrUn.!!$F1 2350
2 TraesCS4D01G140000 chrUn 233523815 233526159 2344 True 4198 4198 98.937 1 2351 1 chrUn.!!$R1 2350
3 TraesCS4D01G140000 chr2D 637307247 637309596 2349 True 4157 4157 98.596 1 2351 1 chr2D.!!$R2 2350
4 TraesCS4D01G140000 chr2D 306151996 306154341 2345 False 4120 4120 98.342 1 2351 1 chr2D.!!$F1 2350
5 TraesCS4D01G140000 chr6D 283186521 283188871 2350 False 4076 4076 97.959 1 2351 1 chr6D.!!$F1 2350
6 TraesCS4D01G140000 chr7D 307088606 307090953 2347 False 4056 4056 97.831 1 2351 1 chr7D.!!$F1 2350
7 TraesCS4D01G140000 chr4B 495536322 495538665 2343 True 4030 4030 97.661 1 2351 1 chr4B.!!$R1 2350
8 TraesCS4D01G140000 chr2A 444302027 444304378 2351 False 3988 3988 97.280 1 2351 1 chr2A.!!$F4 2350

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
308 310 4.32087 GAACAAATAGGTGGTCTTTCCGA 58.679 43.478 0.0 0.0 39.52 4.55 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1702 1708 0.461339 GGCATTCGGGAAGCGACTAA 60.461 55.0 0.0 0.0 0.0 2.24 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
85 86 6.198237 TGGAAAACCCATTGGATCAATTTT 57.802 33.333 3.62 3.24 40.82 1.82
308 310 4.320870 GAACAAATAGGTGGTCTTTCCGA 58.679 43.478 0.00 0.00 39.52 4.55
1622 1628 1.513158 GCGACAGCTTCTGCCTCTA 59.487 57.895 0.00 0.00 40.80 2.43
1678 1684 2.813172 GTCTCTATGTAGTAGTCGGCCC 59.187 54.545 0.00 0.00 0.00 5.80
1802 1808 0.530744 AACGCACGCTAGATGGAGAA 59.469 50.000 0.00 0.00 0.00 2.87
1861 1867 4.157120 GCTTCCGCGCCCTTCCTA 62.157 66.667 0.00 0.00 0.00 2.94
2054 2060 1.306642 AAGATGTCTCCGACGCGACT 61.307 55.000 15.93 0.00 34.95 4.18
2274 2280 8.375506 GGTTCATAGTTGGGTATGATATTCTCA 58.624 37.037 0.00 0.00 38.83 3.27
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
85 86 9.659135 ATGAAGATCAATTATTGGGTAAATGGA 57.341 29.630 5.02 0.00 0.00 3.41
498 502 6.776603 GGACTCCTGTAGGTAATAAGAAGCTA 59.223 42.308 0.00 0.00 36.34 3.32
514 519 3.314331 CGGCAGTGGGACTCCTGT 61.314 66.667 0.00 0.00 32.20 4.00
516 521 1.229082 TAACGGCAGTGGGACTCCT 60.229 57.895 0.00 0.00 0.00 3.69
1622 1628 0.530744 TGAGCGATAGTGAAGCCGTT 59.469 50.000 0.00 0.00 39.35 4.44
1702 1708 0.461339 GGCATTCGGGAAGCGACTAA 60.461 55.000 0.00 0.00 0.00 2.24
1861 1867 4.768448 TCATTCACATCAATTGAAGCAGGT 59.232 37.500 13.09 3.49 36.44 4.00
2054 2060 7.147373 CCCCTATAAAAATCTAGTGGAAGTCCA 60.147 40.741 0.00 0.00 45.30 4.02
2274 2280 1.354368 AGGACGTTCCCAACAATCCAT 59.646 47.619 0.00 0.00 38.28 3.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.