Multiple sequence alignment - TraesCS4D01G139900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G139900 chr4D 100.000 2399 0 0 1 2399 123655988 123653590 0 4431
1 TraesCS4D01G139900 chr4D 99.291 2399 17 0 1 2399 123509289 123506891 0 4337
2 TraesCS4D01G139900 chr4D 99.167 2402 15 4 1 2399 123738786 123736387 0 4320
3 TraesCS4D01G139900 chr4D 95.290 2399 108 5 1 2399 285094179 285096572 0 3799
4 TraesCS4D01G139900 chr7D 99.125 2401 16 3 1 2399 579028592 579030989 0 4313
5 TraesCS4D01G139900 chr6D 98.458 2400 35 2 1 2399 108466576 108468974 0 4226
6 TraesCS4D01G139900 chr6D 97.065 1465 37 4 1 1461 57920046 57921508 0 2462
7 TraesCS4D01G139900 chrUn 95.773 2413 69 20 1 2399 221549554 221547161 0 3860
8 TraesCS4D01G139900 chrUn 95.605 2412 75 19 1 2399 186192552 186190159 0 3838
9 TraesCS4D01G139900 chr7B 95.321 2415 77 23 1 2399 743004926 743007320 0 3801
10 TraesCS4D01G139900 chr7A 94.898 2411 84 20 1 2399 120879320 120881703 0 3735
11 TraesCS4D01G139900 chr7A 97.498 1439 34 2 1 1438 211291173 211292610 0 2457
12 TraesCS4D01G139900 chr5A 97.571 1441 32 1 1 1438 534932662 534934102 0 2464
13 TraesCS4D01G139900 chr3B 96.470 1473 45 5 1 1469 730160399 730161868 0 2425


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G139900 chr4D 123653590 123655988 2398 True 4431 4431 100.000 1 2399 1 chr4D.!!$R2 2398
1 TraesCS4D01G139900 chr4D 123506891 123509289 2398 True 4337 4337 99.291 1 2399 1 chr4D.!!$R1 2398
2 TraesCS4D01G139900 chr4D 123736387 123738786 2399 True 4320 4320 99.167 1 2399 1 chr4D.!!$R3 2398
3 TraesCS4D01G139900 chr4D 285094179 285096572 2393 False 3799 3799 95.290 1 2399 1 chr4D.!!$F1 2398
4 TraesCS4D01G139900 chr7D 579028592 579030989 2397 False 4313 4313 99.125 1 2399 1 chr7D.!!$F1 2398
5 TraesCS4D01G139900 chr6D 108466576 108468974 2398 False 4226 4226 98.458 1 2399 1 chr6D.!!$F2 2398
6 TraesCS4D01G139900 chr6D 57920046 57921508 1462 False 2462 2462 97.065 1 1461 1 chr6D.!!$F1 1460
7 TraesCS4D01G139900 chrUn 221547161 221549554 2393 True 3860 3860 95.773 1 2399 1 chrUn.!!$R2 2398
8 TraesCS4D01G139900 chrUn 186190159 186192552 2393 True 3838 3838 95.605 1 2399 1 chrUn.!!$R1 2398
9 TraesCS4D01G139900 chr7B 743004926 743007320 2394 False 3801 3801 95.321 1 2399 1 chr7B.!!$F1 2398
10 TraesCS4D01G139900 chr7A 120879320 120881703 2383 False 3735 3735 94.898 1 2399 1 chr7A.!!$F1 2398
11 TraesCS4D01G139900 chr7A 211291173 211292610 1437 False 2457 2457 97.498 1 1438 1 chr7A.!!$F2 1437
12 TraesCS4D01G139900 chr5A 534932662 534934102 1440 False 2464 2464 97.571 1 1438 1 chr5A.!!$F1 1437
13 TraesCS4D01G139900 chr3B 730160399 730161868 1469 False 2425 2425 96.470 1 1469 1 chr3B.!!$F1 1468

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
251 254 2.224606 GATGCTGCTATGGCTTGCTTA 58.775 47.619 16.93 2.8 38.57 3.09 F
462 465 4.621274 CGGGAATCATCCTTTGCAAATTGT 60.621 41.667 13.23 0.0 45.77 2.71 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1323 1336 0.605083 ACAAGTCGAGAGCATGCTCA 59.395 50.0 40.91 23.68 44.99 4.26 R
1606 1631 6.407202 GGGCTAATTCCATACGAATCAGTAT 58.593 40.0 0.00 0.00 40.47 2.12 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
251 254 2.224606 GATGCTGCTATGGCTTGCTTA 58.775 47.619 16.93 2.80 38.57 3.09
416 419 8.400184 TCAAAAGCATCCAGAAATATCATAGG 57.600 34.615 0.00 0.00 0.00 2.57
462 465 4.621274 CGGGAATCATCCTTTGCAAATTGT 60.621 41.667 13.23 0.00 45.77 2.71
1043 1052 4.688413 GGAATTTGTGGCGCTTTATCAAAA 59.312 37.500 7.64 0.00 32.99 2.44
1606 1631 0.394762 GATGGGCACATGCTTCTCCA 60.395 55.000 5.94 2.99 41.70 3.86
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
251 254 4.516652 AGCCAATAGAAGAAAGAGCCAT 57.483 40.909 0.00 0.00 0.00 4.40
462 465 1.786441 ACTTGATTGGTTCCCTTCCCA 59.214 47.619 0.00 0.00 0.00 4.37
1043 1052 3.607490 TCGGTAGATAAGGCCCTACTT 57.393 47.619 14.28 0.00 36.43 2.24
1323 1336 0.605083 ACAAGTCGAGAGCATGCTCA 59.395 50.000 40.91 23.68 44.99 4.26
1606 1631 6.407202 GGGCTAATTCCATACGAATCAGTAT 58.593 40.000 0.00 0.00 40.47 2.12
1932 1957 7.814587 AGACTAAAAATTGCTAAATCAACTGCC 59.185 33.333 0.00 0.00 0.00 4.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.