Multiple sequence alignment - TraesCS4D01G139800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G139800 chr4D 100.000 3353 0 0 1 3353 123638852 123642204 0 6192
1 TraesCS4D01G139800 chr4D 98.509 3354 47 3 1 3353 123469973 123466622 0 5914
2 TraesCS4D01G139800 chrUn 99.016 3354 31 2 1 3353 182449184 182445832 0 6010
3 TraesCS4D01G139800 chrUn 97.424 854 10 2 1 843 281719521 281720373 0 1445
4 TraesCS4D01G139800 chr7A 98.514 3365 38 2 1 3353 60349357 60345993 0 5927
5 TraesCS4D01G139800 chr7A 97.534 3366 46 5 1 3353 60174225 60177566 0 5722
6 TraesCS4D01G139800 chr7A 97.744 1241 15 3 1 1230 60158359 60157121 0 2124
7 TraesCS4D01G139800 chr5A 98.455 3365 39 3 1 3353 16538879 16535516 0 5914
8 TraesCS4D01G139800 chr7B 98.395 3365 41 3 1 3353 716910722 716907359 0 5903
9 TraesCS4D01G139800 chr7B 98.336 3365 42 3 1 3353 742954441 742957803 0 5891
10 TraesCS4D01G139800 chr7B 98.276 3365 44 4 1 3353 716778905 716775543 0 5880
11 TraesCS4D01G139800 chr2B 98.187 3365 48 3 1 3353 391172741 391169378 0 5864
12 TraesCS4D01G139800 chr7D 99.038 3016 23 2 339 3353 382102547 382099537 0 5404


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G139800 chr4D 123638852 123642204 3352 False 6192 6192 100.000 1 3353 1 chr4D.!!$F1 3352
1 TraesCS4D01G139800 chr4D 123466622 123469973 3351 True 5914 5914 98.509 1 3353 1 chr4D.!!$R1 3352
2 TraesCS4D01G139800 chrUn 182445832 182449184 3352 True 6010 6010 99.016 1 3353 1 chrUn.!!$R1 3352
3 TraesCS4D01G139800 chrUn 281719521 281720373 852 False 1445 1445 97.424 1 843 1 chrUn.!!$F1 842
4 TraesCS4D01G139800 chr7A 60345993 60349357 3364 True 5927 5927 98.514 1 3353 1 chr7A.!!$R2 3352
5 TraesCS4D01G139800 chr7A 60174225 60177566 3341 False 5722 5722 97.534 1 3353 1 chr7A.!!$F1 3352
6 TraesCS4D01G139800 chr7A 60157121 60158359 1238 True 2124 2124 97.744 1 1230 1 chr7A.!!$R1 1229
7 TraesCS4D01G139800 chr5A 16535516 16538879 3363 True 5914 5914 98.455 1 3353 1 chr5A.!!$R1 3352
8 TraesCS4D01G139800 chr7B 716907359 716910722 3363 True 5903 5903 98.395 1 3353 1 chr7B.!!$R2 3352
9 TraesCS4D01G139800 chr7B 742954441 742957803 3362 False 5891 5891 98.336 1 3353 1 chr7B.!!$F1 3352
10 TraesCS4D01G139800 chr7B 716775543 716778905 3362 True 5880 5880 98.276 1 3353 1 chr7B.!!$R1 3352
11 TraesCS4D01G139800 chr2B 391169378 391172741 3363 True 5864 5864 98.187 1 3353 1 chr2B.!!$R1 3352
12 TraesCS4D01G139800 chr7D 382099537 382102547 3010 True 5404 5404 99.038 339 3353 1 chr7D.!!$R1 3014

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
173 174 1.328986 GTAGTGAGCCGTACCGACTAC 59.671 57.143 0.0 0.0 34.08 2.73 F
1118 1135 1.339727 GGGTTGGTTATTCGTCAGCCT 60.340 52.381 0.0 0.0 33.23 4.58 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1392 1409 3.641437 ATGCGACATCTCTCTTAGCTC 57.359 47.619 0.0 0.0 0.0 4.09 R
2696 2714 0.178990 GGCTGGGTGTCAAAGTCCTT 60.179 55.000 0.0 0.0 0.0 3.36 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
173 174 1.328986 GTAGTGAGCCGTACCGACTAC 59.671 57.143 0.00 0.0 34.08 2.73
207 208 3.242543 GGCTTCAAGATCACAGTAATGCG 60.243 47.826 0.00 0.0 0.00 4.73
276 277 7.792364 TTCTCTAGACACCTTGGAAAAGATA 57.208 36.000 0.00 0.0 0.00 1.98
635 647 3.134081 ACACACATATTCCTCCCTTACGG 59.866 47.826 0.00 0.0 0.00 4.02
1118 1135 1.339727 GGGTTGGTTATTCGTCAGCCT 60.340 52.381 0.00 0.0 33.23 4.58
1392 1409 7.042658 GGTTGTAGTATTTCCGCTCTTTCTATG 60.043 40.741 0.00 0.0 0.00 2.23
1453 1470 9.342308 GATCTTATAATTCATGGACCAAAGTCA 57.658 33.333 0.00 0.0 45.48 3.41
2194 2212 5.106442 CCGGTGAAAATTATAAACAAGGCC 58.894 41.667 0.00 0.0 0.00 5.19
2311 2329 3.075148 TCGGCCAAACGAATATTTCACA 58.925 40.909 2.24 0.0 40.34 3.58
2696 2714 3.589641 TGAAGGACCAAACCACCTACTA 58.410 45.455 0.00 0.0 33.34 1.82
2855 2873 3.106672 CGTCATCTACTACTGCGAAACC 58.893 50.000 0.00 0.0 0.00 3.27
2996 3014 5.049198 TCGTTAGCTCTTAGTGAAGACGAAA 60.049 40.000 0.00 0.0 36.75 3.46
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
207 208 1.484653 ACCCAAGGAAAGTTTTGGCAC 59.515 47.619 0.00 0.00 41.99 5.01
276 277 4.576463 ACTTTGAAATTGAGCTCGTCAGTT 59.424 37.500 9.64 0.79 36.71 3.16
565 577 3.529634 TTAGCGTTGTCATTTTCACGG 57.470 42.857 0.00 0.00 0.00 4.94
826 841 8.126074 GGAGAAAGAGAACACTTCTTTTCTTTC 58.874 37.037 13.89 13.89 43.07 2.62
1118 1135 5.144100 TCCTATTTTTCCAAGTGAAAGCCA 58.856 37.500 0.00 0.00 43.57 4.75
1184 1201 5.065235 CCAAGAAAAATGAAGGTTGGCAAT 58.935 37.500 1.92 0.00 0.00 3.56
1191 1208 8.869109 TGTTGAATATCCAAGAAAAATGAAGGT 58.131 29.630 0.00 0.00 0.00 3.50
1392 1409 3.641437 ATGCGACATCTCTCTTAGCTC 57.359 47.619 0.00 0.00 0.00 4.09
2194 2212 2.194271 GCAGTACGAAATCCTTCCTCG 58.806 52.381 0.00 0.00 38.53 4.63
2311 2329 2.586648 AAATCCCTTGTCGGCTTTCT 57.413 45.000 0.00 0.00 0.00 2.52
2696 2714 0.178990 GGCTGGGTGTCAAAGTCCTT 60.179 55.000 0.00 0.00 0.00 3.36
2996 3014 1.375140 CGCCCGCAGATGATAGCAT 60.375 57.895 0.00 0.00 37.47 3.79


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.