Multiple sequence alignment - TraesCS4D01G139700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G139700 chr4D 100.000 2243 0 0 1 2243 123561060 123563302 0 4143
1 TraesCS4D01G139700 chr4D 98.477 1641 25 0 603 2243 123350724 123352364 0 2892
2 TraesCS4D01G139700 chr4D 97.263 1644 41 2 603 2243 134980026 134981668 0 2784
3 TraesCS4D01G139700 chr4D 96.705 1639 48 4 603 2241 240994174 240992542 0 2723
4 TraesCS4D01G139700 chr4D 99.329 596 4 0 1 596 123346595 123347190 0 1079
5 TraesCS4D01G139700 chr5D 97.745 1641 33 4 603 2243 301055002 301056638 0 2822
6 TraesCS4D01G139700 chr5D 98.993 596 6 0 1 596 301050874 301051469 0 1068
7 TraesCS4D01G139700 chr6D 97.503 1642 35 5 603 2243 370023107 370024743 0 2800
8 TraesCS4D01G139700 chr6D 97.584 1159 26 2 1085 2243 369972796 369971640 0 1984
9 TraesCS4D01G139700 chr1D 97.195 1640 42 4 603 2242 269426161 269424526 0 2771
10 TraesCS4D01G139700 chr1D 98.826 596 7 0 1 596 269430208 269429613 0 1062
11 TraesCS4D01G139700 chr6A 93.914 1643 65 11 603 2243 79196552 79198161 0 2447
12 TraesCS4D01G139700 chr6A 98.826 596 7 0 1 596 375864288 375863693 0 1062
13 TraesCS4D01G139700 chr7D 99.013 1216 11 1 1028 2243 382029169 382027955 0 2178
14 TraesCS4D01G139700 chr7D 99.664 596 2 0 1 596 579038243 579038838 0 1090
15 TraesCS4D01G139700 chr7B 95.782 806 30 4 603 1407 247473710 247474512 0 1297
16 TraesCS4D01G139700 chr7B 98.305 708 11 1 603 1310 742948135 742947429 0 1240
17 TraesCS4D01G139700 chr7A 98.305 708 11 1 603 1310 60168164 60167458 0 1240
18 TraesCS4D01G139700 chr2A 99.832 596 1 0 1 596 755477021 755477616 0 1096
19 TraesCS4D01G139700 chrUn 99.497 596 3 0 1 596 394183947 394183352 0 1085
20 TraesCS4D01G139700 chr2D 99.497 596 3 0 1 596 200922771 200923366 0 1085
21 TraesCS4D01G139700 chr5A 99.329 596 4 0 1 596 238872476 238873071 0 1079


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G139700 chr4D 123561060 123563302 2242 False 4143.0 4143 100.0000 1 2243 1 chr4D.!!$F1 2242
1 TraesCS4D01G139700 chr4D 134980026 134981668 1642 False 2784.0 2784 97.2630 603 2243 1 chr4D.!!$F2 1640
2 TraesCS4D01G139700 chr4D 240992542 240994174 1632 True 2723.0 2723 96.7050 603 2241 1 chr4D.!!$R1 1638
3 TraesCS4D01G139700 chr4D 123346595 123352364 5769 False 1985.5 2892 98.9030 1 2243 2 chr4D.!!$F3 2242
4 TraesCS4D01G139700 chr5D 301050874 301056638 5764 False 1945.0 2822 98.3690 1 2243 2 chr5D.!!$F1 2242
5 TraesCS4D01G139700 chr6D 370023107 370024743 1636 False 2800.0 2800 97.5030 603 2243 1 chr6D.!!$F1 1640
6 TraesCS4D01G139700 chr6D 369971640 369972796 1156 True 1984.0 1984 97.5840 1085 2243 1 chr6D.!!$R1 1158
7 TraesCS4D01G139700 chr1D 269424526 269430208 5682 True 1916.5 2771 98.0105 1 2242 2 chr1D.!!$R1 2241
8 TraesCS4D01G139700 chr6A 79196552 79198161 1609 False 2447.0 2447 93.9140 603 2243 1 chr6A.!!$F1 1640
9 TraesCS4D01G139700 chr6A 375863693 375864288 595 True 1062.0 1062 98.8260 1 596 1 chr6A.!!$R1 595
10 TraesCS4D01G139700 chr7D 382027955 382029169 1214 True 2178.0 2178 99.0130 1028 2243 1 chr7D.!!$R1 1215
11 TraesCS4D01G139700 chr7D 579038243 579038838 595 False 1090.0 1090 99.6640 1 596 1 chr7D.!!$F1 595
12 TraesCS4D01G139700 chr7B 247473710 247474512 802 False 1297.0 1297 95.7820 603 1407 1 chr7B.!!$F1 804
13 TraesCS4D01G139700 chr7B 742947429 742948135 706 True 1240.0 1240 98.3050 603 1310 1 chr7B.!!$R1 707
14 TraesCS4D01G139700 chr7A 60167458 60168164 706 True 1240.0 1240 98.3050 603 1310 1 chr7A.!!$R1 707
15 TraesCS4D01G139700 chr2A 755477021 755477616 595 False 1096.0 1096 99.8320 1 596 1 chr2A.!!$F1 595
16 TraesCS4D01G139700 chrUn 394183352 394183947 595 True 1085.0 1085 99.4970 1 596 1 chrUn.!!$R1 595
17 TraesCS4D01G139700 chr2D 200922771 200923366 595 False 1085.0 1085 99.4970 1 596 1 chr2D.!!$F1 595
18 TraesCS4D01G139700 chr5A 238872476 238873071 595 False 1079.0 1079 99.3290 1 596 1 chr5A.!!$F1 595

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
597 598 0.378257 CGATCCAACAAGGGAATGCG 59.622 55.0 0.0 0.0 41.12 4.73 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2019 5582 0.907704 TGGAGCATACCCAGAACGGT 60.908 55.0 0.0 0.0 40.13 4.83 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
596 597 0.740737 CCGATCCAACAAGGGAATGC 59.259 55.000 0.00 0.0 41.12 3.56
597 598 0.378257 CGATCCAACAAGGGAATGCG 59.622 55.000 0.00 0.0 41.12 4.73
599 600 2.639065 GATCCAACAAGGGAATGCGTA 58.361 47.619 0.00 0.0 41.12 4.42
600 601 2.570415 TCCAACAAGGGAATGCGTAA 57.430 45.000 0.00 0.0 38.24 3.18
625 4154 7.170393 ACCAATAGGCTATTTTGGACTTTTC 57.830 36.000 26.17 0.0 42.02 2.29
663 4192 2.017138 TAGATTTTCGTGCCATGCGA 57.983 45.000 0.00 0.0 36.51 5.10
681 4210 1.603802 CGAAAACCAAGCTGCTGAGAA 59.396 47.619 1.35 0.0 0.00 2.87
1013 4542 3.487711 CGACTCGAGATGTTAGAAGGTGG 60.488 52.174 21.68 0.0 0.00 4.61
1373 4930 2.247358 GAATGGAAAAGGGGTGCTTCA 58.753 47.619 0.00 0.0 0.00 3.02
1569 5132 1.639722 TCCCTCCTTGATCGTGACAA 58.360 50.000 0.00 0.0 0.00 3.18
2019 5582 2.167693 CCCGACAGTAATGCTAAGGACA 59.832 50.000 0.00 0.0 0.00 4.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
596 597 6.317893 AGTCCAAAATAGCCTATTGGTTTACG 59.682 38.462 0.0 0.0 43.27 3.18
597 598 7.640597 AGTCCAAAATAGCCTATTGGTTTAC 57.359 36.000 0.0 0.0 43.27 2.01
599 600 7.553504 AAAGTCCAAAATAGCCTATTGGTTT 57.446 32.000 0.0 0.0 43.27 3.27
600 601 7.553504 AAAAGTCCAAAATAGCCTATTGGTT 57.446 32.000 0.0 0.0 43.27 3.67
663 4192 3.494332 AGATTCTCAGCAGCTTGGTTTT 58.506 40.909 0.0 0.0 0.00 2.43
681 4210 1.281925 CCCTTGTGGCTGGGGTAGAT 61.282 60.000 0.0 0.0 39.76 1.98
716 4245 1.522900 CTGGGTGGGGTATCCTGAAT 58.477 55.000 0.0 0.0 36.20 2.57
1013 4542 2.548480 GCTCCGGCACCTATTGATTTAC 59.452 50.000 0.0 0.0 38.54 2.01
1069 4622 2.835027 AGAACTGAGGACGTTTCCAAC 58.165 47.619 0.0 0.0 45.72 3.77
1373 4930 3.581332 TCAAAAGTGGTTACTCCCGATCT 59.419 43.478 0.0 0.0 35.69 2.75
1569 5132 2.887151 AGTGCTTGCCTAACCTGATT 57.113 45.000 0.0 0.0 0.00 2.57
1676 5239 2.029288 CACGGTTGCACATCGCTCT 61.029 57.895 0.0 0.0 43.06 4.09
2019 5582 0.907704 TGGAGCATACCCAGAACGGT 60.908 55.000 0.0 0.0 40.13 4.83


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.