Multiple sequence alignment - TraesCS4D01G139500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G139500 chr4D 100.000 2594 0 0 1 2594 123549893 123552486 0.000000e+00 4791
1 TraesCS4D01G139500 chr5A 98.580 2605 22 3 1 2594 19248877 19246277 0.000000e+00 4591
2 TraesCS4D01G139500 chr7D 98.541 2605 24 3 1 2594 381973800 381971199 0.000000e+00 4588
3 TraesCS4D01G139500 chr7B 98.461 2599 30 3 1 2594 716878813 716876220 0.000000e+00 4569
4 TraesCS4D01G139500 chr7B 98.346 2599 34 3 1 2594 742989413 742992007 0.000000e+00 4553
5 TraesCS4D01G139500 chr1A 98.461 2599 31 2 1 2594 498691260 498688666 0.000000e+00 4569
6 TraesCS4D01G139500 chr7A 98.384 2599 33 2 1 2594 60279280 60281874 0.000000e+00 4558
7 TraesCS4D01G139500 chrUn 98.269 2599 36 2 1 2594 186208454 186205860 0.000000e+00 4542
8 TraesCS4D01G139500 chr4B 97.268 2599 60 3 1 2594 209299632 209302224 0.000000e+00 4396
9 TraesCS4D01G139500 chr3B 97.000 2600 65 6 1 2594 797592967 797590375 0.000000e+00 4357
10 TraesCS4D01G139500 chr2B 96.285 323 3 2 2277 2594 112843445 112843763 2.960000e-144 521
11 TraesCS4D01G139500 chr6B 96.809 282 4 1 2318 2594 297475555 297475836 1.410000e-127 466


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G139500 chr4D 123549893 123552486 2593 False 4791 4791 100.000 1 2594 1 chr4D.!!$F1 2593
1 TraesCS4D01G139500 chr5A 19246277 19248877 2600 True 4591 4591 98.580 1 2594 1 chr5A.!!$R1 2593
2 TraesCS4D01G139500 chr7D 381971199 381973800 2601 True 4588 4588 98.541 1 2594 1 chr7D.!!$R1 2593
3 TraesCS4D01G139500 chr7B 716876220 716878813 2593 True 4569 4569 98.461 1 2594 1 chr7B.!!$R1 2593
4 TraesCS4D01G139500 chr7B 742989413 742992007 2594 False 4553 4553 98.346 1 2594 1 chr7B.!!$F1 2593
5 TraesCS4D01G139500 chr1A 498688666 498691260 2594 True 4569 4569 98.461 1 2594 1 chr1A.!!$R1 2593
6 TraesCS4D01G139500 chr7A 60279280 60281874 2594 False 4558 4558 98.384 1 2594 1 chr7A.!!$F1 2593
7 TraesCS4D01G139500 chrUn 186205860 186208454 2594 True 4542 4542 98.269 1 2594 1 chrUn.!!$R1 2593
8 TraesCS4D01G139500 chr4B 209299632 209302224 2592 False 4396 4396 97.268 1 2594 1 chr4B.!!$F1 2593
9 TraesCS4D01G139500 chr3B 797590375 797592967 2592 True 4357 4357 97.000 1 2594 1 chr3B.!!$R1 2593

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
502 504 2.145536 GGGTAAGGAAAACGCTTTCGA 58.854 47.619 5.28 0.0 41.7 3.71 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1927 1929 0.530288 CGTTTTCCGCCCCAAATGAT 59.47 50.0 0.0 0.0 0.0 2.45 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
166 167 3.071892 TCCCTCTGTCTTTTTCCGCTTTA 59.928 43.478 0.00 0.00 0.00 1.85
502 504 2.145536 GGGTAAGGAAAACGCTTTCGA 58.854 47.619 5.28 0.00 41.70 3.71
832 834 2.350772 GCCGTCTGATGGAAAACAACTG 60.351 50.000 19.98 0.00 0.00 3.16
1070 1072 4.957759 TCCTTTCTATTGCGCCTAAAAC 57.042 40.909 4.18 0.00 0.00 2.43
1716 1718 3.181500 CGAGTCTGATACATCAACCGTCA 60.181 47.826 0.00 0.00 36.18 4.35
1824 1826 1.587876 CCAGTTACTGCGCGCGATA 60.588 57.895 37.18 20.67 0.00 2.92
1825 1827 1.143373 CCAGTTACTGCGCGCGATAA 61.143 55.000 37.18 23.95 0.00 1.75
1859 1861 1.524165 CCCGTCGGTTGTTGGAACA 60.524 57.895 11.06 0.00 37.08 3.18
1927 1929 4.631234 ACAGAGGTGACTAATTCCCCATA 58.369 43.478 0.00 0.00 44.43 2.74
2010 2012 1.804748 GAAAGAACGGCGAAGTCCATT 59.195 47.619 16.62 6.16 0.00 3.16
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
166 167 2.361438 CGCGTTAGAGGGGAAGATTAGT 59.639 50.000 0.00 0.00 0.00 2.24
502 504 8.352201 TGAAAAACAAATCGACATCTCAATCTT 58.648 29.630 0.00 0.00 0.00 2.40
832 834 1.687628 CTCTCTGAACCGAACGTGAC 58.312 55.000 0.00 0.00 0.00 3.67
1070 1072 6.258727 ACGTGACATATTTGCAGAAATAGAGG 59.741 38.462 0.00 0.00 37.44 3.69
1338 1340 2.560504 CGTAATGCTGGAACTATGGCA 58.439 47.619 0.00 0.00 39.06 4.92
1546 1548 4.749099 ACGACCTATAACGCTAGTCACTAG 59.251 45.833 7.56 7.56 37.16 2.57
1716 1718 4.341520 GGACTCGTACAAGGATATGGAGTT 59.658 45.833 0.00 0.00 0.00 3.01
1769 1771 0.609131 AGGCCAACTTCCATTCACCG 60.609 55.000 5.01 0.00 0.00 4.94
1824 1826 1.971357 CGGGGAGCACCTCAGTATATT 59.029 52.381 0.00 0.00 40.03 1.28
1825 1827 1.133136 ACGGGGAGCACCTCAGTATAT 60.133 52.381 0.00 0.00 40.03 0.86
1927 1929 0.530288 CGTTTTCCGCCCCAAATGAT 59.470 50.000 0.00 0.00 0.00 2.45
2010 2012 3.780804 TTTCTTCATTGGAGGGTTCGA 57.219 42.857 0.00 0.00 0.00 3.71
2374 2382 2.365105 CCCCTTCCCGGCTACTGA 60.365 66.667 0.00 0.00 0.00 3.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.