Multiple sequence alignment - TraesCS4D01G139300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G139300 chr4D 100.000 3616 0 0 1 3616 123542972 123546587 0 6678
1 TraesCS4D01G139300 chr4D 98.175 3617 64 2 1 3616 123385310 123388925 0 6312
2 TraesCS4D01G139300 chr7D 98.839 3617 41 1 1 3616 626633160 626629544 0 6445
3 TraesCS4D01G139300 chr7D 98.756 3616 45 0 1 3616 626727411 626723796 0 6429
4 TraesCS4D01G139300 chr7D 98.673 3618 44 4 1 3616 382070431 382074046 0 6412
5 TraesCS4D01G139300 chr1D 98.728 3617 44 2 1 3616 212461785 212458170 0 6423
6 TraesCS4D01G139300 chr3D 97.899 3618 56 6 1 3616 602875962 602872363 0 6242
7 TraesCS4D01G139300 chrUn 98.762 2907 34 2 711 3616 170992796 170995701 0 5168
8 TraesCS4D01G139300 chr7B 98.693 2907 37 1 711 3616 743098112 743095206 0 5156
9 TraesCS4D01G139300 chr7B 98.591 2909 38 2 711 3616 644448649 644445741 0 5142
10 TraesCS4D01G139300 chr6B 99.032 723 7 0 1 723 394517214 394517936 0 1297
11 TraesCS4D01G139300 chr6B 98.479 723 10 1 1 723 394408027 394408748 0 1273
12 TraesCS4D01G139300 chr5A 98.617 723 10 0 1 723 16594557 16593835 0 1280


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G139300 chr4D 123542972 123546587 3615 False 6678 6678 100.000 1 3616 1 chr4D.!!$F2 3615
1 TraesCS4D01G139300 chr4D 123385310 123388925 3615 False 6312 6312 98.175 1 3616 1 chr4D.!!$F1 3615
2 TraesCS4D01G139300 chr7D 626629544 626633160 3616 True 6445 6445 98.839 1 3616 1 chr7D.!!$R1 3615
3 TraesCS4D01G139300 chr7D 626723796 626727411 3615 True 6429 6429 98.756 1 3616 1 chr7D.!!$R2 3615
4 TraesCS4D01G139300 chr7D 382070431 382074046 3615 False 6412 6412 98.673 1 3616 1 chr7D.!!$F1 3615
5 TraesCS4D01G139300 chr1D 212458170 212461785 3615 True 6423 6423 98.728 1 3616 1 chr1D.!!$R1 3615
6 TraesCS4D01G139300 chr3D 602872363 602875962 3599 True 6242 6242 97.899 1 3616 1 chr3D.!!$R1 3615
7 TraesCS4D01G139300 chrUn 170992796 170995701 2905 False 5168 5168 98.762 711 3616 1 chrUn.!!$F1 2905
8 TraesCS4D01G139300 chr7B 743095206 743098112 2906 True 5156 5156 98.693 711 3616 1 chr7B.!!$R2 2905
9 TraesCS4D01G139300 chr7B 644445741 644448649 2908 True 5142 5142 98.591 711 3616 1 chr7B.!!$R1 2905
10 TraesCS4D01G139300 chr6B 394517214 394517936 722 False 1297 1297 99.032 1 723 1 chr6B.!!$F2 722
11 TraesCS4D01G139300 chr6B 394408027 394408748 721 False 1273 1273 98.479 1 723 1 chr6B.!!$F1 722
12 TraesCS4D01G139300 chr5A 16593835 16594557 722 True 1280 1280 98.617 1 723 1 chr5A.!!$R1 722

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
201 202 2.622942 TGACAAAAGGAACCAGCATGTC 59.377 45.455 0.0 0.0 36.97 3.06 F
1158 1160 1.820519 GTCCATTGCTGGCTTGAATGA 59.179 47.619 0.0 0.0 42.80 2.57 F
1936 1941 0.328258 GGGAAGGCAAGGCTAAGACA 59.672 55.000 0.0 0.0 0.00 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1936 1941 0.250467 CTACCCATATGCAAGGCGCT 60.250 55.0 7.64 0.0 43.06 5.92 R
2486 2492 0.252761 TCAGGCCAATCTGCGAATCA 59.747 50.0 5.01 0.0 34.91 2.57 R
3341 3347 0.034896 GAACCCGCACTCAGGAAGAA 59.965 55.0 0.00 0.0 0.00 2.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
201 202 2.622942 TGACAAAAGGAACCAGCATGTC 59.377 45.455 0.00 0.00 36.97 3.06
276 277 7.656137 GCCGGTCTATGTTCTTATTCTTAATCA 59.344 37.037 1.90 0.00 0.00 2.57
1158 1160 1.820519 GTCCATTGCTGGCTTGAATGA 59.179 47.619 0.00 0.00 42.80 2.57
1594 1599 5.933187 TTGCTTTTTATGAAGTCGCACTA 57.067 34.783 0.00 0.00 0.00 2.74
1639 1644 5.046520 CAGAATAGCTCCATGGATCTCATCA 60.047 44.000 21.18 4.84 32.92 3.07
1646 1651 4.395625 TCCATGGATCTCATCAGAAATGC 58.604 43.478 11.44 0.00 32.92 3.56
1655 1660 4.575236 TCTCATCAGAAATGCTTGATGCTC 59.425 41.667 9.07 0.00 43.37 4.26
1863 1868 2.438434 CCGCCCTGCCTTTCGATT 60.438 61.111 0.00 0.00 0.00 3.34
1936 1941 0.328258 GGGAAGGCAAGGCTAAGACA 59.672 55.000 0.00 0.00 0.00 3.41
2108 2113 2.260434 GGTGAACCACGCGAGCTA 59.740 61.111 15.93 0.00 34.83 3.32
2169 2175 4.371624 TCTTGATCCAGCCTTTTCTTCA 57.628 40.909 0.00 0.00 0.00 3.02
2208 2214 1.084018 AAAATCCAAGGGAGGCTGGA 58.916 50.000 0.00 0.00 45.65 3.86
2243 2249 1.893315 ATACCCATACAGTGCCAGGT 58.107 50.000 0.00 0.00 0.00 4.00
2378 2384 3.985019 TCTTACATAAGGTTCCCGCAA 57.015 42.857 0.00 0.00 34.14 4.85
3087 3093 4.694760 TTCATGCAGCTACTATGGTCAT 57.305 40.909 0.00 0.00 0.00 3.06
3325 3331 5.389411 CGTCTTTCACTTAATGAATCACGCA 60.389 40.000 12.96 0.00 46.80 5.24
3341 3347 7.331440 TGAATCACGCATTTTTCAAAGCATTAT 59.669 29.630 0.00 0.00 0.00 1.28
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
201 202 4.215185 TCTCTATCTGTAGATTCAGCAGCG 59.785 45.833 0.00 0.00 36.40 5.18
540 541 3.589288 AGACTTAGAAGCTTCATGGGGTT 59.411 43.478 27.57 8.22 0.00 4.11
763 764 9.516314 TCATCTATCGTAAAATTCTATATGCCG 57.484 33.333 0.00 0.00 0.00 5.69
1086 1088 1.373590 GGCCGTCGTTGGTGCATAAT 61.374 55.000 0.00 0.00 0.00 1.28
1158 1160 4.493547 CGAGCAAAGAAGAAGAGAGACAT 58.506 43.478 0.00 0.00 0.00 3.06
1423 1427 9.431887 AGTAGATACATAAGATCGAGTCTCTTC 57.568 37.037 3.10 0.00 35.67 2.87
1646 1651 0.324091 AAGCCCCAAGGAGCATCAAG 60.324 55.000 0.00 0.00 36.25 3.02
1655 1660 2.639327 CGCCAAAGAAGCCCCAAGG 61.639 63.158 0.00 0.00 0.00 3.61
1750 1755 3.525545 GGGTAGGAGCGGGTCGAC 61.526 72.222 7.13 7.13 0.00 4.20
1863 1868 1.555075 GGCCTCCTCAACTGTGTATCA 59.445 52.381 0.00 0.00 0.00 2.15
1936 1941 0.250467 CTACCCATATGCAAGGCGCT 60.250 55.000 7.64 0.00 43.06 5.92
2108 2113 3.399046 TGCCCCACGCATCTAACT 58.601 55.556 0.00 0.00 44.64 2.24
2169 2175 7.767659 GGATTTTAGGTGATTAACTACCGAAGT 59.232 37.037 4.75 2.34 41.85 3.01
2208 2214 1.343465 GGTATAGGTATGGCGTGCAGT 59.657 52.381 0.00 0.00 0.00 4.40
2243 2249 2.432444 CAAAAATGAGTCCACCGCCTA 58.568 47.619 0.00 0.00 0.00 3.93
2310 2316 1.066908 CGCTTTCCTTTGCCACTCAAA 59.933 47.619 0.00 0.00 42.01 2.69
2378 2384 2.154462 CGGCTCACCAACTTGATCTTT 58.846 47.619 0.00 0.00 34.57 2.52
2486 2492 0.252761 TCAGGCCAATCTGCGAATCA 59.747 50.000 5.01 0.00 34.91 2.57
3087 3093 2.159393 GCTATCATGAAAACGCCAGCAA 60.159 45.455 0.00 0.00 0.00 3.91
3325 3331 9.649167 CTCAGGAAGAATAATGCTTTGAAAAAT 57.351 29.630 0.00 0.00 0.00 1.82
3341 3347 0.034896 GAACCCGCACTCAGGAAGAA 59.965 55.000 0.00 0.00 0.00 2.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.