Multiple sequence alignment - TraesCS4D01G139200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G139200 chr4D 100.000 2357 0 0 1 2357 123520835 123518479 0 4353
1 TraesCS4D01G139200 chr7D 98.812 2357 28 0 1 2357 579015579 579017935 0 4198
2 TraesCS4D01G139200 chrUn 98.812 2357 25 1 1 2357 237257829 237255476 0 4194
3 TraesCS4D01G139200 chr5A 98.475 2360 33 1 1 2357 16577919 16575560 0 4156
4 TraesCS4D01G139200 chr1A 98.475 2360 33 1 1 2357 238109744 238107385 0 4156
5 TraesCS4D01G139200 chr1A 98.390 2360 35 1 1 2357 238155129 238152770 0 4145
6 TraesCS4D01G139200 chr6B 98.345 2357 38 1 1 2357 596657305 596654950 0 4135
7 TraesCS4D01G139200 chr7A 98.220 2360 39 1 1 2357 60329009 60326650 0 4122


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G139200 chr4D 123518479 123520835 2356 True 4353 4353 100.000 1 2357 1 chr4D.!!$R1 2356
1 TraesCS4D01G139200 chr7D 579015579 579017935 2356 False 4198 4198 98.812 1 2357 1 chr7D.!!$F1 2356
2 TraesCS4D01G139200 chrUn 237255476 237257829 2353 True 4194 4194 98.812 1 2357 1 chrUn.!!$R1 2356
3 TraesCS4D01G139200 chr5A 16575560 16577919 2359 True 4156 4156 98.475 1 2357 1 chr5A.!!$R1 2356
4 TraesCS4D01G139200 chr1A 238107385 238109744 2359 True 4156 4156 98.475 1 2357 1 chr1A.!!$R1 2356
5 TraesCS4D01G139200 chr1A 238152770 238155129 2359 True 4145 4145 98.390 1 2357 1 chr1A.!!$R2 2356
6 TraesCS4D01G139200 chr6B 596654950 596657305 2355 True 4135 4135 98.345 1 2357 1 chr6B.!!$R1 2356
7 TraesCS4D01G139200 chr7A 60326650 60329009 2359 True 4122 4122 98.220 1 2357 1 chr7A.!!$R1 2356

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
174 175 2.163509 CCTGTCTTCTCTCTTGGTCGA 58.836 52.381 0.0 0.0 0.0 4.2 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1440 1442 1.298788 GGTCCGTGCACCGTTTTTG 60.299 57.895 12.15 0.0 33.66 2.44 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
23 24 4.302455 GTGGATCGATCATGACGAGAATT 58.698 43.478 25.93 8.22 42.81 2.17
43 44 7.106239 AGAATTGACTTCTCCGTCATGTAATT 58.894 34.615 0.00 0.00 40.26 1.40
174 175 2.163509 CCTGTCTTCTCTCTTGGTCGA 58.836 52.381 0.00 0.00 0.00 4.20
535 536 6.145696 CGAAATTACGTGAGAGAAAGAACCTT 59.854 38.462 0.00 0.00 0.00 3.50
574 575 3.238441 CGTCGGATAGAATAGCTGCTTC 58.762 50.000 7.79 0.00 32.26 3.86
962 963 2.659016 CTCCGTGAGCAAGGAGCA 59.341 61.111 17.28 0.00 46.87 4.26
1162 1163 0.036010 CTCCGGTGATGCCAGAAGTT 60.036 55.000 0.00 0.00 36.97 2.66
1440 1442 6.535150 TCAATTGATTCGTCATGGTAGAGAAC 59.465 38.462 3.38 0.00 0.00 3.01
1449 1451 4.514066 GTCATGGTAGAGAACAAAAACGGT 59.486 41.667 0.00 0.00 0.00 4.83
1567 1569 6.971184 GCTCTACGTAAGATAGCAAAAGTACA 59.029 38.462 11.75 0.00 43.62 2.90
1833 1838 1.150536 GGGGGCGATATGGAAGCAA 59.849 57.895 0.00 0.00 0.00 3.91
2026 2031 8.541234 ACTAATCTTTTAGTAGGCTAAGTTGCT 58.459 33.333 0.00 0.00 44.90 3.91
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
43 44 3.005472 CAGGACCGTGACTCTTCTAAACA 59.995 47.826 0.00 0.00 0.00 2.83
174 175 2.526432 TGAGAAACTTAGCCTCCGACT 58.474 47.619 0.00 0.00 0.00 4.18
535 536 0.673985 CGGCGGACTCCATCAATCTA 59.326 55.000 0.00 0.00 0.00 1.98
560 561 4.276183 CCTAGTCACGAAGCAGCTATTCTA 59.724 45.833 0.00 0.00 0.00 2.10
574 575 2.409651 GCTCCGCTCCTAGTCACG 59.590 66.667 0.00 0.00 0.00 4.35
1440 1442 1.298788 GGTCCGTGCACCGTTTTTG 60.299 57.895 12.15 0.00 33.66 2.44
1449 1451 2.669229 TCGAGTACGGTCCGTGCA 60.669 61.111 30.38 10.76 44.29 4.57
1567 1569 8.501580 CAAATATATCATGTCGATTGCTCAACT 58.498 33.333 0.00 0.00 35.39 3.16
1833 1838 4.344390 CGTAATAAGGGAAAGGGAGCTAGT 59.656 45.833 0.00 0.00 0.00 2.57
2003 2008 7.394816 TCAGCAACTTAGCCTACTAAAAGATT 58.605 34.615 0.00 0.00 37.91 2.40
2026 2031 5.412594 GTGCCTGTAGTGATTTCAGAATTCA 59.587 40.000 8.44 3.97 0.00 2.57
2241 2249 8.877864 AAAGAATGACACTTGGAAATATGGTA 57.122 30.769 0.00 0.00 0.00 3.25


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.