Multiple sequence alignment - TraesCS4D01G139100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G139100 chr4D 100.000 2378 0 0 1 2378 123520434 123518057 0 4392
1 TraesCS4D01G139100 chrUn 98.696 2378 28 1 1 2378 237257428 237255054 0 4217
2 TraesCS4D01G139100 chr7D 98.654 2378 32 0 1 2378 579015980 579018357 0 4215
3 TraesCS4D01G139100 chr5A 97.984 2381 45 1 1 2378 16577518 16575138 0 4128
4 TraesCS4D01G139100 chr1A 97.984 2381 45 1 1 2378 238109343 238106963 0 4128
5 TraesCS4D01G139100 chr1A 97.984 2381 45 1 1 2378 238154728 238152348 0 4128
6 TraesCS4D01G139100 chr7A 97.858 2381 48 1 1 2378 60328608 60326228 0 4111
7 TraesCS4D01G139100 chr6B 97.855 2378 50 1 1 2378 596656904 596654528 0 4108
8 TraesCS4D01G139100 chr3B 97.438 2381 56 3 1 2378 483372718 483375096 0 4054
9 TraesCS4D01G139100 chr3B 96.220 2381 86 2 1 2378 575769021 575766642 0 3895


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G139100 chr4D 123518057 123520434 2377 True 4392 4392 100.000 1 2378 1 chr4D.!!$R1 2377
1 TraesCS4D01G139100 chrUn 237255054 237257428 2374 True 4217 4217 98.696 1 2378 1 chrUn.!!$R1 2377
2 TraesCS4D01G139100 chr7D 579015980 579018357 2377 False 4215 4215 98.654 1 2378 1 chr7D.!!$F1 2377
3 TraesCS4D01G139100 chr5A 16575138 16577518 2380 True 4128 4128 97.984 1 2378 1 chr5A.!!$R1 2377
4 TraesCS4D01G139100 chr1A 238106963 238109343 2380 True 4128 4128 97.984 1 2378 1 chr1A.!!$R1 2377
5 TraesCS4D01G139100 chr1A 238152348 238154728 2380 True 4128 4128 97.984 1 2378 1 chr1A.!!$R2 2377
6 TraesCS4D01G139100 chr7A 60326228 60328608 2380 True 4111 4111 97.858 1 2378 1 chr7A.!!$R1 2377
7 TraesCS4D01G139100 chr6B 596654528 596656904 2376 True 4108 4108 97.855 1 2378 1 chr6B.!!$R1 2377
8 TraesCS4D01G139100 chr3B 483372718 483375096 2378 False 4054 4054 97.438 1 2378 1 chr3B.!!$F1 2377
9 TraesCS4D01G139100 chr3B 575766642 575769021 2379 True 3895 3895 96.220 1 2378 1 chr3B.!!$R1 2377

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
761 762 0.03601 CTCCGGTGATGCCAGAAGTT 60.036 55.0 0.0 0.0 36.97 2.66 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1961 1972 0.534873 TCCGCGACATTCTCATTCCA 59.465 50.0 8.23 0.0 0.0 3.53 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
134 135 6.145696 CGAAATTACGTGAGAGAAAGAACCTT 59.854 38.462 0.00 0.00 0.00 3.50
173 174 3.238441 CGTCGGATAGAATAGCTGCTTC 58.762 50.000 7.79 0.00 32.26 3.86
761 762 0.036010 CTCCGGTGATGCCAGAAGTT 60.036 55.000 0.00 0.00 36.97 2.66
1039 1041 6.535150 TCAATTGATTCGTCATGGTAGAGAAC 59.465 38.462 3.38 0.00 0.00 3.01
1048 1050 4.514066 GTCATGGTAGAGAACAAAAACGGT 59.486 41.667 0.00 0.00 0.00 4.83
1166 1168 6.971184 GCTCTACGTAAGATAGCAAAAGTACA 59.029 38.462 11.75 0.00 43.62 2.90
1432 1437 1.150536 GGGGGCGATATGGAAGCAA 59.849 57.895 0.00 0.00 0.00 3.91
1625 1630 8.541234 ACTAATCTTTTAGTAGGCTAAGTTGCT 58.459 33.333 0.00 0.00 44.90 3.91
2133 2144 4.584743 GGAGTTGACTTCCAAGGTTGAAAT 59.415 41.667 0.00 0.00 35.03 2.17
2191 2202 1.521457 GGGTGAATCTGCGCGATCA 60.521 57.895 12.10 2.25 0.00 2.92
2353 2364 1.827969 CTCGGTGAACCAGATTCTCCT 59.172 52.381 0.00 0.00 45.26 3.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
134 135 0.673985 CGGCGGACTCCATCAATCTA 59.326 55.000 0.00 0.00 0.00 1.98
159 160 4.276183 CCTAGTCACGAAGCAGCTATTCTA 59.724 45.833 0.00 0.00 0.00 2.10
173 174 2.409651 GCTCCGCTCCTAGTCACG 59.590 66.667 0.00 0.00 0.00 4.35
1039 1041 1.298788 GGTCCGTGCACCGTTTTTG 60.299 57.895 12.15 0.00 33.66 2.44
1048 1050 2.669229 TCGAGTACGGTCCGTGCA 60.669 61.111 30.38 10.76 44.29 4.57
1166 1168 8.501580 CAAATATATCATGTCGATTGCTCAACT 58.498 33.333 0.00 0.00 35.39 3.16
1432 1437 4.344390 CGTAATAAGGGAAAGGGAGCTAGT 59.656 45.833 0.00 0.00 0.00 2.57
1602 1607 7.394816 TCAGCAACTTAGCCTACTAAAAGATT 58.605 34.615 0.00 0.00 37.91 2.40
1625 1630 5.412594 GTGCCTGTAGTGATTTCAGAATTCA 59.587 40.000 8.44 3.97 0.00 2.57
1840 1851 8.877864 AAAGAATGACACTTGGAAATATGGTA 57.122 30.769 0.00 0.00 0.00 3.25
1961 1972 0.534873 TCCGCGACATTCTCATTCCA 59.465 50.000 8.23 0.00 0.00 3.53
2133 2144 6.097839 AGGAGTGCCTACTTCGTGAAATATTA 59.902 38.462 0.00 0.00 44.74 0.98


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.