Multiple sequence alignment - TraesCS4D01G138800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G138800 chr4D 100.000 2465 0 0 1 2465 123450063 123447599 0.000000e+00 4553
1 TraesCS4D01G138800 chr3B 98.824 2465 22 3 1 2465 92297809 92295352 0.000000e+00 4385
2 TraesCS4D01G138800 chr3B 98.458 2465 31 2 1 2465 6011843 6009386 0.000000e+00 4335
3 TraesCS4D01G138800 chr3A 98.580 2465 29 1 1 2465 495105837 495103379 0.000000e+00 4353
4 TraesCS4D01G138800 chr2B 98.499 2465 31 1 1 2465 234542237 234539779 0.000000e+00 4342
5 TraesCS4D01G138800 chr6D 98.419 2467 35 3 1 2465 458942429 458939965 0.000000e+00 4337
6 TraesCS4D01G138800 chr6D 98.054 2466 40 3 1 2465 108484131 108486589 0.000000e+00 4281
7 TraesCS4D01G138800 chrUn 98.458 2465 31 2 1 2465 217906591 217909048 0.000000e+00 4335
8 TraesCS4D01G138800 chrUn 97.368 380 4 1 2086 2465 354406207 354405834 2.070000e-180 641
9 TraesCS4D01G138800 chrUn 97.368 380 4 1 2086 2465 440315210 440315583 2.070000e-180 641
10 TraesCS4D01G138800 chr4A 98.296 2465 36 1 1 2465 67518421 67520879 0.000000e+00 4314
11 TraesCS4D01G138800 chr7A 98.256 2465 37 1 1 2465 563523175 563520717 0.000000e+00 4309
12 TraesCS4D01G138800 chr7D 97.647 2465 49 3 1 2465 307147698 307145243 0.000000e+00 4222
13 TraesCS4D01G138800 chr7D 97.606 2465 52 2 1 2465 307038985 307041442 0.000000e+00 4218
14 TraesCS4D01G138800 chr5D 95.601 341 9 1 2125 2465 395351279 395351613 2.160000e-150 542
15 TraesCS4D01G138800 chr4B 94.301 193 5 1 2273 2465 209107731 209107917 8.620000e-75 291


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G138800 chr4D 123447599 123450063 2464 True 4553 4553 100.000 1 2465 1 chr4D.!!$R1 2464
1 TraesCS4D01G138800 chr3B 92295352 92297809 2457 True 4385 4385 98.824 1 2465 1 chr3B.!!$R2 2464
2 TraesCS4D01G138800 chr3B 6009386 6011843 2457 True 4335 4335 98.458 1 2465 1 chr3B.!!$R1 2464
3 TraesCS4D01G138800 chr3A 495103379 495105837 2458 True 4353 4353 98.580 1 2465 1 chr3A.!!$R1 2464
4 TraesCS4D01G138800 chr2B 234539779 234542237 2458 True 4342 4342 98.499 1 2465 1 chr2B.!!$R1 2464
5 TraesCS4D01G138800 chr6D 458939965 458942429 2464 True 4337 4337 98.419 1 2465 1 chr6D.!!$R1 2464
6 TraesCS4D01G138800 chr6D 108484131 108486589 2458 False 4281 4281 98.054 1 2465 1 chr6D.!!$F1 2464
7 TraesCS4D01G138800 chrUn 217906591 217909048 2457 False 4335 4335 98.458 1 2465 1 chrUn.!!$F1 2464
8 TraesCS4D01G138800 chr4A 67518421 67520879 2458 False 4314 4314 98.296 1 2465 1 chr4A.!!$F1 2464
9 TraesCS4D01G138800 chr7A 563520717 563523175 2458 True 4309 4309 98.256 1 2465 1 chr7A.!!$R1 2464
10 TraesCS4D01G138800 chr7D 307145243 307147698 2455 True 4222 4222 97.647 1 2465 1 chr7D.!!$R1 2464
11 TraesCS4D01G138800 chr7D 307038985 307041442 2457 False 4218 4218 97.606 1 2465 1 chr7D.!!$F1 2464

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
253 254 4.767255 GCAGTGCGGGAGACTGGG 62.767 72.222 0.0 0.0 41.08 4.45 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1484 1486 1.075601 TGCCTGATGGGAACTTCCTT 58.924 50.0 7.77 0.0 36.57 3.36 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
253 254 4.767255 GCAGTGCGGGAGACTGGG 62.767 72.222 0.00 0.0 41.08 4.45
352 353 8.359642 TGATTTGAAGGGTATGTTCTCAAAAAG 58.640 33.333 0.00 0.0 0.00 2.27
1032 1034 1.016130 ACGCTCATTCTTCAGCCGTG 61.016 55.000 0.00 0.0 31.37 4.94
1484 1486 8.913487 ACATGAAGACATTGATAGCAATATGA 57.087 30.769 15.30 0.0 42.66 2.15
1485 1487 9.346005 ACATGAAGACATTGATAGCAATATGAA 57.654 29.630 15.30 0.0 42.66 2.57
2359 2362 5.934935 ACTCCCACGTATAGTTTGTTTTG 57.065 39.130 0.00 0.0 0.00 2.44
2360 2363 4.758165 ACTCCCACGTATAGTTTGTTTTGG 59.242 41.667 0.00 0.0 0.00 3.28
2361 2364 4.073549 TCCCACGTATAGTTTGTTTTGGG 58.926 43.478 0.00 0.0 43.42 4.12
2362 2365 3.191791 CCCACGTATAGTTTGTTTTGGGG 59.808 47.826 0.00 0.0 39.09 4.96
2425 2436 0.676782 CCGGGCCTAAGTGAAAGTGG 60.677 60.000 0.84 0.0 0.00 4.00
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
19 20 2.938451 CAGTTATGCTTCGGATGCTTCA 59.062 45.455 15.69 0.43 0.00 3.02
50 51 2.323959 CTATCTCTCGGCAAAGATCGC 58.676 52.381 0.00 0.00 34.21 4.58
253 254 2.419713 GGGAGTTTACTCGACCCATTCC 60.420 54.545 3.96 0.00 43.76 3.01
352 353 4.571176 CGAAGTATTTACCTCTGCCTTTCC 59.429 45.833 0.00 0.00 0.00 3.13
870 872 4.258543 CAATAAGGTCACCCATAACACGT 58.741 43.478 0.00 0.00 0.00 4.49
1032 1034 5.066593 ACCTCACAATTCAAAAGTCTCTCC 58.933 41.667 0.00 0.00 0.00 3.71
1484 1486 1.075601 TGCCTGATGGGAACTTCCTT 58.924 50.000 7.77 0.00 36.57 3.36
1485 1487 1.075601 TTGCCTGATGGGAACTTCCT 58.924 50.000 7.77 0.00 38.80 3.36
2275 2278 6.071672 CGAGAGGCATCTTTCCTTATGATCTA 60.072 42.308 0.76 0.00 35.30 1.98
2425 2436 0.673985 GGCCCACCACTTCACTTTTC 59.326 55.000 0.00 0.00 35.26 2.29


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.