Multiple sequence alignment - TraesCS4D01G138700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G138700 chr4D 100.000 2192 0 0 1 2192 123448985 123446794 0 4048
1 TraesCS4D01G138700 chr3B 98.403 2192 28 3 1 2192 92296731 92294547 0 3847
2 TraesCS4D01G138700 chr6D 98.358 2193 31 3 1 2191 458941352 458939163 0 3845
3 TraesCS4D01G138700 chr3A 98.358 2192 30 1 1 2192 495104759 495102574 0 3843
4 TraesCS4D01G138700 chr2B 98.266 2192 32 1 1 2192 234541159 234538974 0 3832
5 TraesCS4D01G138700 chr2B 97.857 1960 36 1 233 2192 234502228 234500275 0 3382
6 TraesCS4D01G138700 chr1A 98.175 2192 33 2 1 2192 278521195 278523379 0 3819
7 TraesCS4D01G138700 chrUn 98.038 2192 36 2 1 2192 217907669 217909853 0 3803
8 TraesCS4D01G138700 chr7D 97.719 2192 42 3 1 2192 307146622 307144439 0 3764
9 TraesCS4D01G138700 chr6A 98.548 1929 19 2 1 1929 597252992 597251073 0 3398
10 TraesCS4D01G138700 chr6A 95.272 1121 50 1 1072 2192 413577939 413576822 0 1773
11 TraesCS4D01G138700 chr1D 97.383 1643 35 2 462 2104 351038136 351039770 0 2789
12 TraesCS4D01G138700 chr4A 93.780 1688 91 3 1 1687 280911110 280909436 0 2523
13 TraesCS4D01G138700 chr1B 95.050 1394 62 5 800 2189 348908985 348910375 0 2185
14 TraesCS4D01G138700 chr4B 97.395 998 20 1 1195 2192 209107731 209108722 0 1694


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G138700 chr4D 123446794 123448985 2191 True 4048 4048 100.000 1 2192 1 chr4D.!!$R1 2191
1 TraesCS4D01G138700 chr3B 92294547 92296731 2184 True 3847 3847 98.403 1 2192 1 chr3B.!!$R1 2191
2 TraesCS4D01G138700 chr6D 458939163 458941352 2189 True 3845 3845 98.358 1 2191 1 chr6D.!!$R1 2190
3 TraesCS4D01G138700 chr3A 495102574 495104759 2185 True 3843 3843 98.358 1 2192 1 chr3A.!!$R1 2191
4 TraesCS4D01G138700 chr2B 234538974 234541159 2185 True 3832 3832 98.266 1 2192 1 chr2B.!!$R2 2191
5 TraesCS4D01G138700 chr2B 234500275 234502228 1953 True 3382 3382 97.857 233 2192 1 chr2B.!!$R1 1959
6 TraesCS4D01G138700 chr1A 278521195 278523379 2184 False 3819 3819 98.175 1 2192 1 chr1A.!!$F1 2191
7 TraesCS4D01G138700 chrUn 217907669 217909853 2184 False 3803 3803 98.038 1 2192 1 chrUn.!!$F1 2191
8 TraesCS4D01G138700 chr7D 307144439 307146622 2183 True 3764 3764 97.719 1 2192 1 chr7D.!!$R1 2191
9 TraesCS4D01G138700 chr6A 597251073 597252992 1919 True 3398 3398 98.548 1 1929 1 chr6A.!!$R2 1928
10 TraesCS4D01G138700 chr6A 413576822 413577939 1117 True 1773 1773 95.272 1072 2192 1 chr6A.!!$R1 1120
11 TraesCS4D01G138700 chr1D 351038136 351039770 1634 False 2789 2789 97.383 462 2104 1 chr1D.!!$F1 1642
12 TraesCS4D01G138700 chr4A 280909436 280911110 1674 True 2523 2523 93.780 1 1687 1 chr4A.!!$R1 1686
13 TraesCS4D01G138700 chr1B 348908985 348910375 1390 False 2185 2185 95.050 800 2189 1 chr1B.!!$F1 1389
14 TraesCS4D01G138700 chr4B 209107731 209108722 991 False 1694 1694 97.395 1195 2192 1 chr4B.!!$F1 997

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
406 407 8.913487 ACATGAAGACATTGATAGCAATATGA 57.087 30.769 15.3 0.0 42.66 2.15 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1347 1368 0.673985 GGCCCACCACTTCACTTTTC 59.326 55.0 0.0 0.0 35.26 2.29 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
406 407 8.913487 ACATGAAGACATTGATAGCAATATGA 57.087 30.769 15.30 0.00 42.66 2.15
407 408 9.346005 ACATGAAGACATTGATAGCAATATGAA 57.654 29.630 15.30 0.00 42.66 2.57
1347 1368 0.676782 CCGGGCCTAAGTGAAAGTGG 60.677 60.000 0.84 0.00 0.00 4.00
1623 1644 7.282585 TCTCGAATGAAACTATCCATGGAATT 58.717 34.615 20.67 11.91 0.00 2.17
1656 1677 4.743151 GTGAAACGTAGATCATCGCCATTA 59.257 41.667 8.96 0.00 30.99 1.90
1835 1856 1.566018 CGCTTCGCTTCCGGTTCTTT 61.566 55.000 0.00 0.00 34.56 2.52
2038 2059 1.338674 CGTGGTGGTGCTTCAGGATTA 60.339 52.381 0.00 0.00 0.00 1.75
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
406 407 1.075601 TGCCTGATGGGAACTTCCTT 58.924 50.000 7.77 0.0 36.57 3.36
407 408 1.075601 TTGCCTGATGGGAACTTCCT 58.924 50.000 7.77 0.0 38.80 3.36
917 919 1.818959 TTCATTCGACGTTCCGGGGT 61.819 55.000 0.00 0.0 0.00 4.95
1197 1207 6.071672 CGAGAGGCATCTTTCCTTATGATCTA 60.072 42.308 0.76 0.0 35.30 1.98
1347 1368 0.673985 GGCCCACCACTTCACTTTTC 59.326 55.000 0.00 0.0 35.26 2.29
1623 1644 3.931130 CGTTTCACACGGCGCACA 61.931 61.111 10.83 0.0 45.89 4.57
1835 1856 3.261897 GGAGAAGTCAGTTGATTCCTCCA 59.738 47.826 5.27 0.0 36.47 3.86


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.