Multiple sequence alignment - TraesCS4D01G138600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G138600 chr4D 100.000 2300 0 0 1 2300 123424882 123427181 0 4248
1 TraesCS4D01G138600 chr6A 98.957 2301 22 2 1 2300 608882068 608879769 0 4115
2 TraesCS4D01G138600 chr6A 98.051 2309 34 3 1 2300 84435312 84437618 0 4004
3 TraesCS4D01G138600 chrUn 98.742 2306 23 2 1 2300 86508844 86506539 0 4093
4 TraesCS4D01G138600 chr6B 98.526 2307 27 2 1 2300 596621491 596623797 0 4065
5 TraesCS4D01G138600 chr3B 98.351 2305 32 2 1 2300 92319005 92321308 0 4041
6 TraesCS4D01G138600 chr2B 98.307 2304 33 3 1 2300 30669445 30667144 0 4034
7 TraesCS4D01G138600 chr5B 98.088 2301 41 3 1 2300 567269427 567267129 0 4002
8 TraesCS4D01G138600 chr7A 98.045 2302 40 4 1 2300 563584352 563586650 0 3997
9 TraesCS4D01G138600 chr4A 97.924 2312 33 5 1 2300 67575517 67573209 0 3989


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G138600 chr4D 123424882 123427181 2299 False 4248 4248 100.000 1 2300 1 chr4D.!!$F1 2299
1 TraesCS4D01G138600 chr6A 608879769 608882068 2299 True 4115 4115 98.957 1 2300 1 chr6A.!!$R1 2299
2 TraesCS4D01G138600 chr6A 84435312 84437618 2306 False 4004 4004 98.051 1 2300 1 chr6A.!!$F1 2299
3 TraesCS4D01G138600 chrUn 86506539 86508844 2305 True 4093 4093 98.742 1 2300 1 chrUn.!!$R1 2299
4 TraesCS4D01G138600 chr6B 596621491 596623797 2306 False 4065 4065 98.526 1 2300 1 chr6B.!!$F1 2299
5 TraesCS4D01G138600 chr3B 92319005 92321308 2303 False 4041 4041 98.351 1 2300 1 chr3B.!!$F1 2299
6 TraesCS4D01G138600 chr2B 30667144 30669445 2301 True 4034 4034 98.307 1 2300 1 chr2B.!!$R1 2299
7 TraesCS4D01G138600 chr5B 567267129 567269427 2298 True 4002 4002 98.088 1 2300 1 chr5B.!!$R1 2299
8 TraesCS4D01G138600 chr7A 563584352 563586650 2298 False 3997 3997 98.045 1 2300 1 chr7A.!!$F1 2299
9 TraesCS4D01G138600 chr4A 67573209 67575517 2308 True 3989 3989 97.924 1 2300 1 chr4A.!!$R1 2299

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
603 619 1.400737 TAGCGAAGAGGCTTAGGGAC 58.599 55.0 0.0 0.0 41.39 4.46 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1793 1822 1.134521 TCGCAAAGGATCCGCAATAGT 60.135 47.619 5.98 0.0 0.0 2.12 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
218 222 4.094590 AGGTGTTGAACGATCTACTCTACG 59.905 45.833 8.53 0.00 33.23 3.51
603 619 1.400737 TAGCGAAGAGGCTTAGGGAC 58.599 55.000 0.00 0.00 41.39 4.46
1470 1498 0.389025 AAAAAGGGCGCTGGTGAAAG 59.611 50.000 7.64 0.00 0.00 2.62
1526 1555 1.743252 GCAGCGGGAAAGGAGTCTG 60.743 63.158 0.00 0.00 0.00 3.51
1764 1793 4.036027 TGCTGAGAGAGAAAAGTGCTTTTG 59.964 41.667 13.81 0.07 42.26 2.44
1793 1822 2.860009 AGAGTCCTCGAGTACACACAA 58.140 47.619 11.01 0.00 34.09 3.33
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
3 4 0.184211 AAAGGTACAACGGCCCAAGT 59.816 50.000 0.00 0.0 0.00 3.16
218 222 1.675641 CCTGTAAGCCCACACCTGC 60.676 63.158 0.00 0.0 0.00 4.85
603 619 0.240145 TACGCACCGACACTCTCTTG 59.760 55.000 0.00 0.0 0.00 3.02
746 762 2.584608 GAAGCAGCTTAGCCCCGA 59.415 61.111 7.92 0.0 34.23 5.14
966 983 0.679505 TCACAAGGAGAGGTTCACCG 59.320 55.000 0.00 0.0 42.08 4.94
1119 1146 2.383527 CGCGGCAGAGAACAAGACC 61.384 63.158 0.00 0.0 0.00 3.85
1526 1555 3.828875 ACCAAAGCTAGGCAGATAGAC 57.171 47.619 5.09 0.0 0.00 2.59
1764 1793 3.090790 ACTCGAGGACTCTTAGGGAAAC 58.909 50.000 18.41 0.0 0.00 2.78
1793 1822 1.134521 TCGCAAAGGATCCGCAATAGT 60.135 47.619 5.98 0.0 0.00 2.12


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.