Multiple sequence alignment - TraesCS4D01G138500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G138500 chr4D 100.000 2487 0 0 1 2487 123423714 123426200 0 4593
1 TraesCS4D01G138500 chr6B 98.357 2495 32 4 1 2487 596620323 596622816 0 4372
2 TraesCS4D01G138500 chrUn 98.316 2494 35 3 1 2487 282364697 282362204 0 4366
3 TraesCS4D01G138500 chrUn 98.276 2494 36 3 1 2487 86510013 86507520 0 4361
4 TraesCS4D01G138500 chr3B 98.034 2492 41 4 1 2486 92317837 92320326 0 4324
5 TraesCS4D01G138500 chr2B 97.994 2492 42 5 1 2487 30670612 30668124 0 4318
6 TraesCS4D01G138500 chr3D 97.953 2492 45 3 1 2487 154704961 154702471 0 4314
7 TraesCS4D01G138500 chr6A 97.837 2497 44 3 1 2487 84434143 84436639 0 4303
8 TraesCS4D01G138500 chr5B 97.668 2487 56 2 1 2486 567270596 567268111 0 4270
9 TraesCS4D01G138500 chr4A 97.600 2500 43 7 1 2487 67576685 67574190 0 4268


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G138500 chr4D 123423714 123426200 2486 False 4593 4593 100.000 1 2487 1 chr4D.!!$F1 2486
1 TraesCS4D01G138500 chr6B 596620323 596622816 2493 False 4372 4372 98.357 1 2487 1 chr6B.!!$F1 2486
2 TraesCS4D01G138500 chrUn 282362204 282364697 2493 True 4366 4366 98.316 1 2487 1 chrUn.!!$R2 2486
3 TraesCS4D01G138500 chrUn 86507520 86510013 2493 True 4361 4361 98.276 1 2487 1 chrUn.!!$R1 2486
4 TraesCS4D01G138500 chr3B 92317837 92320326 2489 False 4324 4324 98.034 1 2486 1 chr3B.!!$F1 2485
5 TraesCS4D01G138500 chr2B 30668124 30670612 2488 True 4318 4318 97.994 1 2487 1 chr2B.!!$R1 2486
6 TraesCS4D01G138500 chr3D 154702471 154704961 2490 True 4314 4314 97.953 1 2487 1 chr3D.!!$R1 2486
7 TraesCS4D01G138500 chr6A 84434143 84436639 2496 False 4303 4303 97.837 1 2487 1 chr6A.!!$F1 2486
8 TraesCS4D01G138500 chr5B 567268111 567270596 2485 True 4270 4270 97.668 1 2486 1 chr5B.!!$R1 2485
9 TraesCS4D01G138500 chr4A 67574190 67576685 2495 True 4268 4268 97.600 1 2487 1 chr4A.!!$R1 2486

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
182 183 1.668419 GGAGCATTTAGACGGTGCAT 58.332 50.0 0.0 0.0 41.19 3.96 F
1028 1032 0.878961 GTGCAACGTCGAAAGGGTCT 60.879 55.0 0.0 0.0 0.00 3.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1171 1175 0.184211 AAAGGTACAACGGCCCAAGT 59.816 50.0 0.0 0.0 0.00 3.16 R
2134 2147 0.679505 TCACAAGGAGAGGTTCACCG 59.320 55.0 0.0 0.0 42.08 4.94 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
71 72 3.007398 CAGAACAGGCCTCAGTAGAAAGT 59.993 47.826 0.00 0.0 0.00 2.66
182 183 1.668419 GGAGCATTTAGACGGTGCAT 58.332 50.000 0.00 0.0 41.19 3.96
266 267 4.494484 GCTCAAAAGCCGATTACCAAATT 58.506 39.130 0.00 0.0 43.10 1.82
270 271 6.391537 TCAAAAGCCGATTACCAAATTTACC 58.608 36.000 0.00 0.0 0.00 2.85
905 908 6.016777 GCCCGATCATGAGTGAATAGAAAATT 60.017 38.462 0.09 0.0 38.01 1.82
1028 1032 0.878961 GTGCAACGTCGAAAGGGTCT 60.879 55.000 0.00 0.0 0.00 3.85
1142 1146 5.520748 TTCTCCCTTTTTAGAATGGCTCT 57.479 39.130 0.00 0.0 38.28 4.09
1160 1164 4.991687 GGCTCTAGTGGCTACATTTATGTC 59.008 45.833 10.83 0.0 41.97 3.06
1171 1175 5.874810 GCTACATTTATGTCAAGTCTGGTCA 59.125 40.000 0.00 0.0 41.97 4.02
1386 1391 4.094590 AGGTGTTGAACGATCTACTCTACG 59.905 45.833 8.53 0.0 33.23 3.51
1771 1784 1.400737 TAGCGAAGAGGCTTAGGGAC 58.599 55.000 0.00 0.0 41.39 4.46
2102 2115 5.603170 ATGCATTTCATTCTTTCCGGAAT 57.397 34.783 19.62 0.0 36.49 3.01
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
182 183 3.514706 TGGCGGTAGTGGTCAATACTAAA 59.485 43.478 8.20 0.0 32.84 1.85
266 267 6.674066 CGGTTTCAAGATGCTAAAAAGGTAA 58.326 36.000 0.00 0.0 0.00 2.85
270 271 4.382754 GTGCGGTTTCAAGATGCTAAAAAG 59.617 41.667 0.00 0.0 0.00 2.27
468 471 3.887621 TCAGTGAAGTAATCCCGGAAG 57.112 47.619 0.73 0.0 0.00 3.46
563 566 8.493607 TCCATTTTATGTATCCATCTTGACTCA 58.506 33.333 0.00 0.0 32.29 3.41
905 908 4.633175 TGGAACAGCTATGTACGTTTTCA 58.367 39.130 0.00 0.0 39.29 2.69
1028 1032 2.159156 CCGAACGATCCCACTACATCAA 60.159 50.000 0.00 0.0 0.00 2.57
1142 1146 7.041721 CAGACTTGACATAAATGTAGCCACTA 58.958 38.462 0.00 0.0 41.95 2.74
1171 1175 0.184211 AAAGGTACAACGGCCCAAGT 59.816 50.000 0.00 0.0 0.00 3.16
1386 1391 1.675641 CCTGTAAGCCCACACCTGC 60.676 63.158 0.00 0.0 0.00 4.85
1771 1784 0.240145 TACGCACCGACACTCTCTTG 59.760 55.000 0.00 0.0 0.00 3.02
1914 1927 2.584608 GAAGCAGCTTAGCCCCGA 59.415 61.111 7.92 0.0 34.23 5.14
2102 2115 5.475564 GGGTCAGGTACTTTAATTCTTTGCA 59.524 40.000 0.00 0.0 34.60 4.08
2134 2147 0.679505 TCACAAGGAGAGGTTCACCG 59.320 55.000 0.00 0.0 42.08 4.94
2287 2312 2.383527 CGCGGCAGAGAACAAGACC 61.384 63.158 0.00 0.0 0.00 3.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.