Multiple sequence alignment - TraesCS4D01G138400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G138400 chr4D 100.000 2723 0 0 1 2723 123414378 123417100 0 5029
1 TraesCS4D01G138400 chrUn 99.267 2727 16 2 1 2723 189394035 189396761 0 4922
2 TraesCS4D01G138400 chr5B 99.156 2725 21 1 1 2723 679660393 679663117 0 4903
3 TraesCS4D01G138400 chr7D 99.083 2726 21 2 2 2723 203554849 203552124 0 4892
4 TraesCS4D01G138400 chr7B 99.046 2725 24 1 1 2723 743087695 743090419 0 4887
5 TraesCS4D01G138400 chr5A 99.009 2725 25 1 1 2723 16601427 16598703 0 4881
6 TraesCS4D01G138400 chr5A 98.862 2724 28 2 1 2721 300074475 300077198 0 4855
7 TraesCS4D01G138400 chr6A 98.899 2725 28 1 1 2723 289130126 289132850 0 4865
8 TraesCS4D01G138400 chr2A 98.715 2724 33 2 1 2723 735194150 735196872 0 4835
9 TraesCS4D01G138400 chr3B 98.569 2725 36 2 1 2723 92201097 92203820 0 4813


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G138400 chr4D 123414378 123417100 2722 False 5029 5029 100.000 1 2723 1 chr4D.!!$F1 2722
1 TraesCS4D01G138400 chrUn 189394035 189396761 2726 False 4922 4922 99.267 1 2723 1 chrUn.!!$F1 2722
2 TraesCS4D01G138400 chr5B 679660393 679663117 2724 False 4903 4903 99.156 1 2723 1 chr5B.!!$F1 2722
3 TraesCS4D01G138400 chr7D 203552124 203554849 2725 True 4892 4892 99.083 2 2723 1 chr7D.!!$R1 2721
4 TraesCS4D01G138400 chr7B 743087695 743090419 2724 False 4887 4887 99.046 1 2723 1 chr7B.!!$F1 2722
5 TraesCS4D01G138400 chr5A 16598703 16601427 2724 True 4881 4881 99.009 1 2723 1 chr5A.!!$R1 2722
6 TraesCS4D01G138400 chr5A 300074475 300077198 2723 False 4855 4855 98.862 1 2721 1 chr5A.!!$F1 2720
7 TraesCS4D01G138400 chr6A 289130126 289132850 2724 False 4865 4865 98.899 1 2723 1 chr6A.!!$F1 2722
8 TraesCS4D01G138400 chr2A 735194150 735196872 2722 False 4835 4835 98.715 1 2723 1 chr2A.!!$F1 2722
9 TraesCS4D01G138400 chr3B 92201097 92203820 2723 False 4813 4813 98.569 1 2723 1 chr3B.!!$F1 2722

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
278 279 0.320771 GGGCTCGATGGCGATGTAAT 60.321 55.0 0.0 0.0 46.8 1.89 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2008 2011 1.202348 CCTTTTTGTTCCCATCGAGCC 59.798 52.381 0.0 0.0 0.0 4.7 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
278 279 0.320771 GGGCTCGATGGCGATGTAAT 60.321 55.000 0.00 0.0 46.80 1.89
467 468 3.326297 GGTAGAAGATTGGGCTCTGCTAT 59.674 47.826 0.00 0.0 36.11 2.97
497 498 5.836898 TCCACTCAACTAGGAAAGAAGTACA 59.163 40.000 0.00 0.0 0.00 2.90
1091 1093 4.039973 TGGATCTCGGTTGTTCTTAACAGT 59.960 41.667 0.00 0.0 43.27 3.55
1222 1224 9.850628 TTATTTATATCGCGACAGCTATAAACT 57.149 29.630 24.21 18.1 38.06 2.66
1440 1443 3.378742 TGCGTTTTCAAAAGCTTCCTGTA 59.621 39.130 0.00 0.0 42.61 2.74
1705 1708 5.514274 AGAAATAGAAGCTCGAGAAGGAG 57.486 43.478 18.75 0.0 37.11 3.69
2008 2011 5.606348 ATCCTTAGTCACTAGGCAAGAAG 57.394 43.478 0.00 0.0 0.00 2.85
2679 2686 7.613551 ACTTCGGTACCTATATTCCTGAAAT 57.386 36.000 10.90 0.0 0.00 2.17
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
278 279 5.309806 GCCCTAACTCCCCATTCTTTCTATA 59.690 44.000 0.00 0.00 0.00 1.31
467 468 2.820178 TCCTAGTTGAGTGGATCTGCA 58.180 47.619 0.00 0.00 0.00 4.41
497 498 3.544684 TCAAACAGTCAGTCAGCAATGT 58.455 40.909 0.00 0.00 0.00 2.71
1091 1093 6.483307 CCGAAGACTTAAATGAATAGCCATCA 59.517 38.462 0.00 0.00 0.00 3.07
1222 1224 6.070767 TGTTTTGTTAATGGGAACAAGGAACA 60.071 34.615 12.07 12.07 46.88 3.18
1440 1443 3.433740 GGATTGAAATAGGAGCCGGTTCT 60.434 47.826 18.44 8.30 0.00 3.01
1705 1708 5.233225 AGCGAACTAGGTTTTTAGTGGTAC 58.767 41.667 0.00 0.00 34.24 3.34
1976 1979 6.814146 CCTAGTGACTAAGGATTTTCACACTC 59.186 42.308 0.00 0.00 40.44 3.51
2008 2011 1.202348 CCTTTTTGTTCCCATCGAGCC 59.798 52.381 0.00 0.00 0.00 4.70
2513 2520 2.550855 GCTGACCTCAATGAACCAGACA 60.551 50.000 9.37 0.00 0.00 3.41
2679 2686 4.207891 GTCTTCATGAAGGCCTGTCTTA 57.792 45.455 30.33 9.27 37.07 2.10
2687 2694 6.405176 CCAAAATAGAAGGTCTTCATGAAGGC 60.405 42.308 30.33 29.33 42.04 4.35


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.