Multiple sequence alignment - TraesCS4D01G138300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G138300 chr4D 100.000 2319 0 0 1 2319 123412893 123415211 0 4283
1 TraesCS4D01G138300 chrUn 98.670 2330 20 3 1 2319 189392539 189394868 0 4120
2 TraesCS4D01G138300 chr5A 98.627 2330 21 3 1 2319 300072979 300075308 0 4115
3 TraesCS4D01G138300 chr5A 98.240 2329 28 4 1 2319 16602919 16600594 0 4061
4 TraesCS4D01G138300 chr2A 98.541 2330 23 3 1 2319 618279956 618277627 0 4104
5 TraesCS4D01G138300 chr6A 98.454 2329 25 3 1 2319 289128632 289130959 0 4091
6 TraesCS4D01G138300 chr7D 98.412 2330 26 3 1 2319 626698490 626696161 0 4087
7 TraesCS4D01G138300 chr7D 98.368 2329 28 2 1 2319 203556345 203554017 0 4082
8 TraesCS4D01G138300 chr7B 98.412 2330 26 3 1 2319 743086199 743088528 0 4087
9 TraesCS4D01G138300 chr3B 98.282 2328 30 3 1 2319 92199604 92201930 0 4069
10 TraesCS4D01G138300 chr7A 98.201 2334 27 3 1 2319 4959838 4962171 0 4063
11 TraesCS4D01G138300 chr5B 98.634 1977 15 4 355 2319 679659250 679661226 0 3491


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G138300 chr4D 123412893 123415211 2318 False 4283 4283 100.000 1 2319 1 chr4D.!!$F1 2318
1 TraesCS4D01G138300 chrUn 189392539 189394868 2329 False 4120 4120 98.670 1 2319 1 chrUn.!!$F1 2318
2 TraesCS4D01G138300 chr5A 300072979 300075308 2329 False 4115 4115 98.627 1 2319 1 chr5A.!!$F1 2318
3 TraesCS4D01G138300 chr5A 16600594 16602919 2325 True 4061 4061 98.240 1 2319 1 chr5A.!!$R1 2318
4 TraesCS4D01G138300 chr2A 618277627 618279956 2329 True 4104 4104 98.541 1 2319 1 chr2A.!!$R1 2318
5 TraesCS4D01G138300 chr6A 289128632 289130959 2327 False 4091 4091 98.454 1 2319 1 chr6A.!!$F1 2318
6 TraesCS4D01G138300 chr7D 626696161 626698490 2329 True 4087 4087 98.412 1 2319 1 chr7D.!!$R2 2318
7 TraesCS4D01G138300 chr7D 203554017 203556345 2328 True 4082 4082 98.368 1 2319 1 chr7D.!!$R1 2318
8 TraesCS4D01G138300 chr7B 743086199 743088528 2329 False 4087 4087 98.412 1 2319 1 chr7B.!!$F1 2318
9 TraesCS4D01G138300 chr3B 92199604 92201930 2326 False 4069 4069 98.282 1 2319 1 chr3B.!!$F1 2318
10 TraesCS4D01G138300 chr7A 4959838 4962171 2333 False 4063 4063 98.201 1 2319 1 chr7A.!!$F1 2318
11 TraesCS4D01G138300 chr5B 679659250 679661226 1976 False 3491 3491 98.634 355 2319 1 chr5B.!!$F1 1964

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
550 554 1.238439 ACTTCAAGCACAACCATCCG 58.762 50.0 0.0 0.0 0.0 4.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1952 1975 2.820178 TCCTAGTTGAGTGGATCTGCA 58.18 47.619 0.0 0.0 0.0 4.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
64 65 7.054124 TGAGCAAAAAGATAAGGTCGGAATAT 58.946 34.615 0.00 0.00 0.00 1.28
111 112 7.264294 AGAACATAGATTCCTTCTTCAACCT 57.736 36.000 0.00 0.00 35.79 3.50
183 184 3.082548 CTCTCCTGAACGACACCTTCTA 58.917 50.000 0.00 0.00 0.00 2.10
188 189 3.193691 CCTGAACGACACCTTCTACAGAT 59.806 47.826 0.00 0.00 0.00 2.90
232 233 3.317993 GGCGAGGGTAAATATGTGCATTT 59.682 43.478 0.00 0.00 32.91 2.32
407 408 4.503714 AGGAATCTTTAGATTTGGCGGA 57.496 40.909 6.45 0.00 44.14 5.54
550 554 1.238439 ACTTCAAGCACAACCATCCG 58.762 50.000 0.00 0.00 0.00 4.18
1210 1218 4.100035 CGGATCTATCTAATGGCATGGCTA 59.900 45.833 21.08 7.33 0.00 3.93
1763 1786 0.320771 GGGCTCGATGGCGATGTAAT 60.321 55.000 0.00 0.00 46.80 1.89
1952 1975 3.326297 GGTAGAAGATTGGGCTCTGCTAT 59.674 47.826 0.00 0.00 36.11 2.97
1982 2005 5.836898 TCCACTCAACTAGGAAAGAAGTACA 59.163 40.000 0.00 0.00 0.00 2.90
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
64 65 3.139077 GGAAGCAAAGAAAGAACTCCGA 58.861 45.455 0.00 0.0 0.00 4.55
183 184 5.104485 GGGAAATACCACCAGTAGAATCTGT 60.104 44.000 0.00 0.0 41.20 3.41
188 189 3.443052 TCGGGAAATACCACCAGTAGAA 58.557 45.455 0.00 0.0 41.20 2.10
232 233 4.987408 TTGTCGTTTCCTGACCGATATA 57.013 40.909 0.00 0.0 35.46 0.86
407 408 4.716784 TGTCTGTGCCCTTTGAGTCTATAT 59.283 41.667 0.00 0.0 0.00 0.86
550 554 4.210120 CGATCGGAGATTTTGGATTGAGAC 59.790 45.833 7.38 0.0 45.12 3.36
1054 1059 2.546778 GACGTGTGACTTCCTCAAACA 58.453 47.619 0.00 0.0 36.97 2.83
1210 1218 1.346062 ATAGATCACATCCGCCAGCT 58.654 50.000 0.00 0.0 0.00 4.24
1763 1786 5.309806 GCCCTAACTCCCCATTCTTTCTATA 59.690 44.000 0.00 0.0 0.00 1.31
1952 1975 2.820178 TCCTAGTTGAGTGGATCTGCA 58.180 47.619 0.00 0.0 0.00 4.41
1982 2005 3.544684 TCAAACAGTCAGTCAGCAATGT 58.455 40.909 0.00 0.0 0.00 2.71


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.