Multiple sequence alignment - TraesCS4D01G138200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G138200 chr4D 100.000 2341 0 0 1 2341 123399671 123402011 0 4324
1 TraesCS4D01G138200 chr7A 98.595 2348 23 6 2 2341 638509517 638507172 0 4145
2 TraesCS4D01G138200 chr7A 97.957 2349 35 8 2 2341 708243774 708246118 0 4060
3 TraesCS4D01G138200 chr7D 98.592 2343 28 4 2 2341 382087952 382090292 0 4139
4 TraesCS4D01G138200 chr7D 98.252 2346 30 6 2 2341 626713042 626710702 0 4095
5 TraesCS4D01G138200 chr7D 97.822 2342 45 5 2 2341 307034495 307032158 0 4037
6 TraesCS4D01G138200 chr6B 98.212 2349 31 6 2 2341 596603711 596601365 0 4095
7 TraesCS4D01G138200 chrUn 98.169 2349 32 6 2 2341 171006434 171008780 0 4089
8 TraesCS4D01G138200 chr5B 97.871 2348 38 8 2 2339 567278142 567280487 0 4048
9 TraesCS4D01G138200 chr1B 97.785 2348 40 7 2 2341 672539372 672541715 0 4037


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G138200 chr4D 123399671 123402011 2340 False 4324 4324 100.000 1 2341 1 chr4D.!!$F1 2340
1 TraesCS4D01G138200 chr7A 638507172 638509517 2345 True 4145 4145 98.595 2 2341 1 chr7A.!!$R1 2339
2 TraesCS4D01G138200 chr7A 708243774 708246118 2344 False 4060 4060 97.957 2 2341 1 chr7A.!!$F1 2339
3 TraesCS4D01G138200 chr7D 382087952 382090292 2340 False 4139 4139 98.592 2 2341 1 chr7D.!!$F1 2339
4 TraesCS4D01G138200 chr7D 626710702 626713042 2340 True 4095 4095 98.252 2 2341 1 chr7D.!!$R2 2339
5 TraesCS4D01G138200 chr7D 307032158 307034495 2337 True 4037 4037 97.822 2 2341 1 chr7D.!!$R1 2339
6 TraesCS4D01G138200 chr6B 596601365 596603711 2346 True 4095 4095 98.212 2 2341 1 chr6B.!!$R1 2339
7 TraesCS4D01G138200 chrUn 171006434 171008780 2346 False 4089 4089 98.169 2 2341 1 chrUn.!!$F1 2339
8 TraesCS4D01G138200 chr5B 567278142 567280487 2345 False 4048 4048 97.871 2 2339 1 chr5B.!!$F1 2337
9 TraesCS4D01G138200 chr1B 672539372 672541715 2343 False 4037 4037 97.785 2 2341 1 chr1B.!!$F1 2339

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
364 370 1.436195 AAGCAACTGCAAGCGTTCGA 61.436 50.0 4.22 0.0 45.16 3.71 F
1315 1327 1.522900 AATCATTCCGGTCCTGGGAT 58.477 50.0 0.00 0.0 32.58 3.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1323 1335 0.683973 CCTCAGCTCAGACTGGTGTT 59.316 55.000 1.81 0.0 38.26 3.32 R
2273 2287 1.962807 TCCAACTTCGTACCTTTCCGA 59.037 47.619 0.00 0.0 0.00 4.55 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
364 370 1.436195 AAGCAACTGCAAGCGTTCGA 61.436 50.000 4.22 0.0 45.16 3.71
887 897 2.304761 ACATTCGTTGGGCTTTCCTCTA 59.695 45.455 0.00 0.0 36.20 2.43
888 898 3.054361 ACATTCGTTGGGCTTTCCTCTAT 60.054 43.478 0.00 0.0 36.20 1.98
1122 1132 3.410631 TGCTCATACGGGAAAGTGAAA 57.589 42.857 0.00 0.0 0.00 2.69
1315 1327 1.522900 AATCATTCCGGTCCTGGGAT 58.477 50.000 0.00 0.0 32.58 3.85
1489 1501 2.691409 CCTTCATAGAAAGGCGACCA 57.309 50.000 0.00 0.0 39.47 4.02
1544 1556 3.610260 AGAAAGAGAAGGTAAAGGGGGT 58.390 45.455 0.00 0.0 0.00 4.95
1728 1741 2.261671 GGCGCCGAGAGAAAGACA 59.738 61.111 12.58 0.0 0.00 3.41
1737 1750 4.180057 CCGAGAGAAAGACAAGATTCAGG 58.820 47.826 0.00 0.0 0.00 3.86
1738 1751 4.322349 CCGAGAGAAAGACAAGATTCAGGT 60.322 45.833 0.00 0.0 0.00 4.00
1852 1865 2.225019 ACTTGAATGCGTCTTCTTGCTG 59.775 45.455 0.00 0.0 0.00 4.41
2273 2287 7.005296 ACCTCTCTGAGATATACGGTTTATGT 58.995 38.462 8.00 0.0 0.00 2.29
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 5.279506 GGGCTAGAGGTAATTTCGATGATCA 60.280 44.000 0.00 0.00 0.00 2.92
650 657 5.661056 AGTGTGGATAAATCGACAGAAGA 57.339 39.130 7.90 0.00 44.32 2.87
1323 1335 0.683973 CCTCAGCTCAGACTGGTGTT 59.316 55.000 1.81 0.00 38.26 3.32
1489 1501 2.300437 GGCGAACATCTAATCTAGGCCT 59.700 50.000 11.78 11.78 35.25 5.19
1544 1556 2.069775 TCAAGAATCTCCAAACCCCCA 58.930 47.619 0.00 0.00 0.00 4.96
1640 1653 1.134098 CCACCCTCGCCTATGAAATGT 60.134 52.381 0.00 0.00 0.00 2.71
1728 1741 8.037758 CACTCACTGAATTACTACCTGAATCTT 58.962 37.037 0.00 0.00 0.00 2.40
1737 1750 7.659652 AAGAAAGCACTCACTGAATTACTAC 57.340 36.000 0.00 0.00 0.00 2.73
1738 1751 8.677148 AAAAGAAAGCACTCACTGAATTACTA 57.323 30.769 0.00 0.00 0.00 1.82
1852 1865 3.916761 TGAAATGGAACTTGAATGCTGC 58.083 40.909 0.00 0.00 0.00 5.25
2273 2287 1.962807 TCCAACTTCGTACCTTTCCGA 59.037 47.619 0.00 0.00 0.00 4.55


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.