Multiple sequence alignment - TraesCS4D01G138100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G138100 chr4D 100.000 2234 0 0 1 2234 123401540 123399307 0 4126
1 TraesCS4D01G138100 chr7D 98.569 2236 28 3 1 2234 382089820 382087587 0 3949
2 TraesCS4D01G138100 chr7D 98.258 2239 29 5 1 2234 626711174 626713407 0 3910
3 TraesCS4D01G138100 chr7D 97.852 2235 44 3 1 2234 307032629 307034860 0 3858
4 TraesCS4D01G138100 chr7D 96.734 2235 63 6 1 2234 307162937 307160712 0 3714
5 TraesCS4D01G138100 chr7A 98.438 2241 27 4 1 2234 638507643 638509882 0 3938
6 TraesCS4D01G138100 chr6B 98.171 2242 30 6 1 2234 596601837 596604075 0 3903
7 TraesCS4D01G138100 chr3D 96.828 2238 50 9 1 2234 501886011 501883791 0 3720
8 TraesCS4D01G138100 chr3D 97.132 523 11 1 1 523 602860160 602860678 0 880
9 TraesCS4D01G138100 chr7B 97.752 1913 32 5 330 2234 54050172 54052081 0 3284


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G138100 chr4D 123399307 123401540 2233 True 4126 4126 100.000 1 2234 1 chr4D.!!$R1 2233
1 TraesCS4D01G138100 chr7D 382087587 382089820 2233 True 3949 3949 98.569 1 2234 1 chr7D.!!$R2 2233
2 TraesCS4D01G138100 chr7D 626711174 626713407 2233 False 3910 3910 98.258 1 2234 1 chr7D.!!$F2 2233
3 TraesCS4D01G138100 chr7D 307032629 307034860 2231 False 3858 3858 97.852 1 2234 1 chr7D.!!$F1 2233
4 TraesCS4D01G138100 chr7D 307160712 307162937 2225 True 3714 3714 96.734 1 2234 1 chr7D.!!$R1 2233
5 TraesCS4D01G138100 chr7A 638507643 638509882 2239 False 3938 3938 98.438 1 2234 1 chr7A.!!$F1 2233
6 TraesCS4D01G138100 chr6B 596601837 596604075 2238 False 3903 3903 98.171 1 2234 1 chr6B.!!$F1 2233
7 TraesCS4D01G138100 chr3D 501883791 501886011 2220 True 3720 3720 96.828 1 2234 1 chr3D.!!$R1 2233
8 TraesCS4D01G138100 chr3D 602860160 602860678 518 False 880 880 97.132 1 523 1 chr3D.!!$F1 522
9 TraesCS4D01G138100 chr7B 54050172 54052081 1909 False 3284 3284 97.752 330 2234 1 chr7B.!!$F1 1904

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
546 548 0.683973 CCTCAGCTCAGACTGGTGTT 59.316 55.0 1.81 0.0 38.26 3.32 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1505 1520 1.436195 AAGCAACTGCAAGCGTTCGA 61.436 50.0 4.22 0.0 45.16 3.71 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
131 132 8.677148 AAAAGAAAGCACTCACTGAATTACTA 57.323 30.769 0.00 0.00 0.00 1.82
132 133 7.659652 AAGAAAGCACTCACTGAATTACTAC 57.340 36.000 0.00 0.00 0.00 2.73
141 142 8.037758 CACTCACTGAATTACTACCTGAATCTT 58.962 37.037 0.00 0.00 0.00 2.40
229 230 1.134098 CCACCCTCGCCTATGAAATGT 60.134 52.381 0.00 0.00 0.00 2.71
324 326 2.899303 TCAAGAATCTCCAAACCCCC 57.101 50.000 0.00 0.00 0.00 5.40
325 327 2.069775 TCAAGAATCTCCAAACCCCCA 58.930 47.619 0.00 0.00 0.00 4.96
380 382 2.300437 GGCGAACATCTAATCTAGGCCT 59.700 50.000 11.78 11.78 35.25 5.19
546 548 0.683973 CCTCAGCTCAGACTGGTGTT 59.316 55.000 1.81 0.00 38.26 3.32
1219 1233 5.661056 AGTGTGGATAAATCGACAGAAGA 57.339 39.130 7.90 0.00 44.32 2.87
1869 1890 5.279506 GGGCTAGAGGTAATTTCGATGATCA 60.280 44.000 0.00 0.00 0.00 2.92
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
17 18 2.225019 ACTTGAATGCGTCTTCTTGCTG 59.775 45.455 0.00 0.0 0.00 4.41
131 132 4.322349 CCGAGAGAAAGACAAGATTCAGGT 60.322 45.833 0.00 0.0 0.00 4.00
132 133 4.180057 CCGAGAGAAAGACAAGATTCAGG 58.820 47.826 0.00 0.0 0.00 3.86
141 142 2.261671 GGCGCCGAGAGAAAGACA 59.738 61.111 12.58 0.0 0.00 3.41
324 326 3.330998 AGAAAGAGAAGGTAAAGGGGGTG 59.669 47.826 0.00 0.0 0.00 4.61
325 327 3.610260 AGAAAGAGAAGGTAAAGGGGGT 58.390 45.455 0.00 0.0 0.00 4.95
380 382 2.691409 CCTTCATAGAAAGGCGACCA 57.309 50.000 0.00 0.0 39.47 4.02
554 556 1.522900 AATCATTCCGGTCCTGGGAT 58.477 50.000 0.00 0.0 32.58 3.85
747 754 3.410631 TGCTCATACGGGAAAGTGAAA 57.589 42.857 0.00 0.0 0.00 2.69
981 990 3.054361 ACATTCGTTGGGCTTTCCTCTAT 60.054 43.478 0.00 0.0 36.20 1.98
982 991 2.304761 ACATTCGTTGGGCTTTCCTCTA 59.695 45.455 0.00 0.0 36.20 2.43
1505 1520 1.436195 AAGCAACTGCAAGCGTTCGA 61.436 50.000 4.22 0.0 45.16 3.71
1869 1890 4.295199 GGAACAAAGGGCCGGGGT 62.295 66.667 2.18 0.0 0.00 4.95


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.