Multiple sequence alignment - TraesCS4D01G138000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G138000 chr4D 100.000 2314 0 0 1 2314 123388257 123385944 0.000000e+00 4274
1 TraesCS4D01G138000 chr4D 97.840 2315 48 2 1 2314 123545919 123543606 0.000000e+00 3997
2 TraesCS4D01G138000 chr7D 98.402 2315 35 2 1 2314 626724464 626726777 0.000000e+00 4069
3 TraesCS4D01G138000 chr7D 98.359 2315 37 1 1 2314 626630212 626632526 0.000000e+00 4063
4 TraesCS4D01G138000 chr7D 98.273 2316 38 2 1 2314 382073380 382071065 0.000000e+00 4054
5 TraesCS4D01G138000 chr1D 98.229 2315 39 2 1 2314 212458838 212461151 0.000000e+00 4047
6 TraesCS4D01G138000 chr3D 97.755 2316 49 3 1 2314 602873031 602875345 0.000000e+00 3986
7 TraesCS4D01G138000 chr3D 97.980 99 2 0 2216 2314 572093126 572093028 3.060000e-39 172
8 TraesCS4D01G138000 chrUn 98.392 2239 34 2 1 2238 170995033 170992796 0.000000e+00 3934
9 TraesCS4D01G138000 chrUn 100.000 88 0 0 2227 2314 404476250 404476337 1.840000e-36 163
10 TraesCS4D01G138000 chr7B 98.347 2239 36 1 1 2238 743095874 743098112 0.000000e+00 3928
11 TraesCS4D01G138000 chr7B 98.258 2239 38 1 1 2238 644446411 644448649 0.000000e+00 3917


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G138000 chr4D 123385944 123388257 2313 True 4274 4274 100.000 1 2314 1 chr4D.!!$R1 2313
1 TraesCS4D01G138000 chr4D 123543606 123545919 2313 True 3997 3997 97.840 1 2314 1 chr4D.!!$R2 2313
2 TraesCS4D01G138000 chr7D 626724464 626726777 2313 False 4069 4069 98.402 1 2314 1 chr7D.!!$F2 2313
3 TraesCS4D01G138000 chr7D 626630212 626632526 2314 False 4063 4063 98.359 1 2314 1 chr7D.!!$F1 2313
4 TraesCS4D01G138000 chr7D 382071065 382073380 2315 True 4054 4054 98.273 1 2314 1 chr7D.!!$R1 2313
5 TraesCS4D01G138000 chr1D 212458838 212461151 2313 False 4047 4047 98.229 1 2314 1 chr1D.!!$F1 2313
6 TraesCS4D01G138000 chr3D 602873031 602875345 2314 False 3986 3986 97.755 1 2314 1 chr3D.!!$F1 2313
7 TraesCS4D01G138000 chrUn 170992796 170995033 2237 True 3934 3934 98.392 1 2238 1 chrUn.!!$R1 2237
8 TraesCS4D01G138000 chr7B 743095874 743098112 2238 False 3928 3928 98.347 1 2238 1 chr7B.!!$F2 2237
9 TraesCS4D01G138000 chr7B 644446411 644448649 2238 False 3917 3917 98.258 1 2238 1 chr7B.!!$F1 2237

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
806 808 0.820226 GCTGGATCAAGAAAAGGGGC 59.18 55.0 0.0 0.0 0.0 5.8 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2130 2136 2.175715 AGAAGGAACAAGGCTTGAAGGT 59.824 45.455 32.5 14.6 0.0 3.5 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
74 75 7.821846 ACAAGCAAAAATGGTTGAAAAGTCTAA 59.178 29.630 22.88 0.00 46.59 2.10
126 127 4.199310 TCCCAAGAGCTAATCCAAAATCG 58.801 43.478 0.00 0.00 0.00 3.34
225 226 2.969628 ATGAAGCAAGACCTACTCCG 57.030 50.000 0.00 0.00 0.00 4.63
404 406 5.310451 ACCACAATTAACATCACTACGGTT 58.690 37.500 0.00 0.00 0.00 4.44
692 694 5.269189 TCCCTTCCCTAATCCAAAAATGAC 58.731 41.667 0.00 0.00 0.00 3.06
806 808 0.820226 GCTGGATCAAGAAAAGGGGC 59.180 55.000 0.00 0.00 0.00 5.80
908 911 7.717436 AGAGTTATTCAGTCGATACAGAGATGA 59.283 37.037 0.00 0.00 0.00 2.92
1009 1012 0.550432 TGCTACCCATATGCAAGGCA 59.450 50.000 0.00 2.65 44.86 4.75
1439 1442 5.304357 TCATTATAGCGGTTCCTTCAGATCA 59.696 40.000 0.00 0.00 0.00 2.92
1448 1451 5.874810 CGGTTCCTTCAGATCATAGAAAACA 59.125 40.000 0.00 0.00 0.00 2.83
1845 1851 4.141688 CGATAAAGGTAAAGAGAAGGGGCT 60.142 45.833 0.00 0.00 0.00 5.19
1900 1906 4.285254 CGATCTTTCTCGGTGCATAAGCA 61.285 47.826 0.00 0.00 40.75 3.91
1962 1968 6.408092 CCAATAGACCTTGAATAGCCTGTACA 60.408 42.308 0.00 0.00 0.00 2.90
2130 2136 5.103982 TCAGATTCATTCCCTTGCTAATCCA 60.104 40.000 0.00 0.00 0.00 3.41
2225 2231 7.344913 AGAAATCCTAGCAGTCATTGAGATTT 58.655 34.615 7.23 7.23 35.88 2.17
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
25 26 3.950395 GCTAGTGCTCCCAGAAATGAATT 59.050 43.478 0.00 0.00 36.03 2.17
74 75 8.062065 TGGTTGTTTTACTCTCTTTCAAACAT 57.938 30.769 0.00 0.00 37.24 2.71
126 127 2.010145 TGCTTGTCAATCGAGTAGGC 57.990 50.000 0.00 0.00 0.00 3.93
225 226 4.453480 TCAATTATTCCTGGGATGGGAC 57.547 45.455 0.00 0.00 31.94 4.46
404 406 3.617284 TGACTCTGTGTTCGATAGCCTA 58.383 45.455 0.00 0.00 0.00 3.93
548 550 3.760151 CAGAAGATCAATTTGGTGAGCCA 59.240 43.478 0.00 0.00 44.38 4.75
559 561 1.561542 AGGTTCCCGCAGAAGATCAAT 59.438 47.619 0.00 0.00 34.29 2.57
713 715 3.134081 GCACGCCATACCTATACCCATAT 59.866 47.826 0.00 0.00 0.00 1.78
806 808 1.355916 GCAGAGGGCTCGTAGTACG 59.644 63.158 16.65 16.65 44.19 3.67
1009 1012 0.036294 GAAGGCAAGGCTAAGACGGT 60.036 55.000 0.00 0.00 0.00 4.83
1459 1462 1.093159 CTCGGTAGTTCTGTAGCCGT 58.907 55.000 0.00 0.00 42.62 5.68
1467 1470 0.685097 TGCCTTTGCTCGGTAGTTCT 59.315 50.000 0.00 0.00 38.71 3.01
1570 1576 8.600625 GTCGAAAGTGCTTATATGATTAACACA 58.399 33.333 0.00 0.00 0.00 3.72
1578 1584 8.390354 CAAATCAAGTCGAAAGTGCTTATATGA 58.610 33.333 0.00 0.00 0.00 2.15
1845 1851 2.535012 TCTGTTATGCACCAACGACA 57.465 45.000 8.13 0.00 0.00 4.35
1918 1924 4.717233 TGGCTTTATTGCTTATGTGGTG 57.283 40.909 0.00 0.00 0.00 4.17
2130 2136 2.175715 AGAAGGAACAAGGCTTGAAGGT 59.824 45.455 32.50 14.60 0.00 3.50
2225 2231 3.110705 AGCTGCTTCTTCCTCTGGATTA 58.889 45.455 0.00 0.00 0.00 1.75


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.