Multiple sequence alignment - TraesCS4D01G137900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G137900 chr4D 100.000 2243 0 0 1 2243 123350122 123352364 0 4143
1 TraesCS4D01G137900 chr4D 97.329 2246 56 2 1 2243 134979424 134981668 0 3812
2 TraesCS4D01G137900 chr4D 96.475 2241 71 5 1 2241 240994774 240992542 0 3694
3 TraesCS4D01G137900 chr4D 98.477 1641 25 0 603 2243 123561662 123563302 0 2892
4 TraesCS4D01G137900 chr5D 97.593 2243 49 5 1 2243 301054401 301056638 0 3838
5 TraesCS4D01G137900 chr6D 96.881 2244 51 10 1 2243 370022518 370024743 0 3738
6 TraesCS4D01G137900 chr6D 97.325 1159 29 2 1085 2243 369972796 369971640 0 1967
7 TraesCS4D01G137900 chr1D 96.699 2242 55 5 1 2242 269426748 269424526 0 3712
8 TraesCS4D01G137900 chr6A 94.657 2246 83 13 1 2243 79195950 79198161 0 3448
9 TraesCS4D01G137900 chr7B 98.473 1310 19 1 1 1310 742948737 742947429 0 2307
10 TraesCS4D01G137900 chr7A 98.470 1307 19 1 1 1307 60084937 60086242 0 2302
11 TraesCS4D01G137900 chr7A 98.397 1310 20 1 1 1310 60168766 60167458 0 2302
12 TraesCS4D01G137900 chr7D 98.849 1216 13 1 1028 2243 382029169 382027955 0 2167


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G137900 chr4D 123350122 123352364 2242 False 4143 4143 100.000 1 2243 1 chr4D.!!$F1 2242
1 TraesCS4D01G137900 chr4D 134979424 134981668 2244 False 3812 3812 97.329 1 2243 1 chr4D.!!$F3 2242
2 TraesCS4D01G137900 chr4D 240992542 240994774 2232 True 3694 3694 96.475 1 2241 1 chr4D.!!$R1 2240
3 TraesCS4D01G137900 chr4D 123561662 123563302 1640 False 2892 2892 98.477 603 2243 1 chr4D.!!$F2 1640
4 TraesCS4D01G137900 chr5D 301054401 301056638 2237 False 3838 3838 97.593 1 2243 1 chr5D.!!$F1 2242
5 TraesCS4D01G137900 chr6D 370022518 370024743 2225 False 3738 3738 96.881 1 2243 1 chr6D.!!$F1 2242
6 TraesCS4D01G137900 chr6D 369971640 369972796 1156 True 1967 1967 97.325 1085 2243 1 chr6D.!!$R1 1158
7 TraesCS4D01G137900 chr1D 269424526 269426748 2222 True 3712 3712 96.699 1 2242 1 chr1D.!!$R1 2241
8 TraesCS4D01G137900 chr6A 79195950 79198161 2211 False 3448 3448 94.657 1 2243 1 chr6A.!!$F1 2242
9 TraesCS4D01G137900 chr7B 742947429 742948737 1308 True 2307 2307 98.473 1 1310 1 chr7B.!!$R1 1309
10 TraesCS4D01G137900 chr7A 60084937 60086242 1305 False 2302 2302 98.470 1 1307 1 chr7A.!!$F1 1306
11 TraesCS4D01G137900 chr7A 60167458 60168766 1308 True 2302 2302 98.397 1 1310 1 chr7A.!!$R1 1309
12 TraesCS4D01G137900 chr7D 382027955 382029169 1214 True 2167 2167 98.849 1028 2243 1 chr7D.!!$R1 1215

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
381 382 1.204704 TCAACGGCTTCTGTGATCGAT 59.795 47.619 0.0 0.0 0.0 3.59 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1301 1308 0.179 AGGCCATCATCGACCAAGAC 59.821 55.0 5.01 0.0 0.0 3.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
126 127 4.814234 CAGCTATTAACGTTGGCTTATCCA 59.186 41.667 11.99 0.0 44.85 3.41
263 264 3.260483 GATGCTGCGACTCAGGCG 61.260 66.667 0.00 0.0 43.06 5.52
381 382 1.204704 TCAACGGCTTCTGTGATCGAT 59.795 47.619 0.00 0.0 0.00 3.59
565 567 4.227618 AGGTTGCCCCTTACTCGT 57.772 55.556 0.00 0.0 42.73 4.18
935 940 4.201822 GCCCAAGTACTTCGAATCATCAAC 60.202 45.833 4.77 0.0 0.00 3.18
936 941 4.935205 CCCAAGTACTTCGAATCATCAACA 59.065 41.667 4.77 0.0 0.00 3.33
937 942 5.411361 CCCAAGTACTTCGAATCATCAACAA 59.589 40.000 4.77 0.0 0.00 2.83
1031 1037 3.202906 GTGCTAAATCAATAGGTGCCGA 58.797 45.455 0.00 0.0 0.00 5.54
1400 1407 3.005472 GGGAGTAACCACTTTTGAAAGGC 59.995 47.826 8.23 0.0 41.20 4.35
1728 1741 0.031043 TGAAACTCCTTCGCGTTCGA 59.969 50.000 5.77 0.0 43.89 3.71
1797 1810 7.745620 AGAAATGACTTTGACCTTAACGAAT 57.254 32.000 0.00 0.0 0.00 3.34
1801 1814 5.790593 TGACTTTGACCTTAACGAATAGCT 58.209 37.500 0.00 0.0 0.00 3.32
2018 2031 3.101437 TCCCGACAGTAATGCTAAGGAA 58.899 45.455 0.00 0.0 0.00 3.36
2048 2061 7.149202 TCTGGGTATGCTCCAATTAAATACT 57.851 36.000 0.00 0.0 33.36 2.12
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
76 77 4.585955 ATTCCGCGATAAAAGAGCTCTA 57.414 40.909 18.59 0.95 0.00 2.43
126 127 2.750637 AGACCCGACGCGACTGAT 60.751 61.111 15.93 0.00 0.00 2.90
153 154 5.388944 GCAGACTTGTTTCATAGCTTTCAG 58.611 41.667 0.00 0.00 0.00 3.02
210 211 2.670934 AGCGAAGGCAGCCACTTG 60.671 61.111 15.80 5.27 43.41 3.16
218 219 0.539438 ACCCAAATTGAGCGAAGGCA 60.539 50.000 0.00 0.00 43.41 4.75
263 264 3.623510 GCCTTGCACCTCTATTGAGTAAC 59.376 47.826 3.47 0.00 38.61 2.50
381 382 5.227569 TGAGAAATTCTGTCTAGTGGCAA 57.772 39.130 0.00 0.00 0.00 4.52
565 567 6.405953 CGAGAAAAGCCTTCTTCCTACATCTA 60.406 42.308 0.51 0.00 0.00 1.98
935 940 4.913924 CGCTGTTCTTTCTTGGATTTCTTG 59.086 41.667 0.00 0.00 0.00 3.02
936 941 4.821805 TCGCTGTTCTTTCTTGGATTTCTT 59.178 37.500 0.00 0.00 0.00 2.52
937 942 4.389374 TCGCTGTTCTTTCTTGGATTTCT 58.611 39.130 0.00 0.00 0.00 2.52
1298 1305 2.292267 GCCATCATCGACCAAGACAAT 58.708 47.619 0.00 0.00 0.00 2.71
1301 1308 0.179000 AGGCCATCATCGACCAAGAC 59.821 55.000 5.01 0.00 0.00 3.01
1850 1863 2.125773 AATCTACTGACGGACGAGGT 57.874 50.000 0.00 0.00 0.00 3.85
2018 2031 1.522569 GAGCATACCCAGAACGGCT 59.477 57.895 0.00 0.00 0.00 5.52
2048 2061 8.602472 AAAATAGTAATGCCCCATTCAAACTA 57.398 30.769 0.00 0.00 35.54 2.24


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.