Multiple sequence alignment - TraesCS4D01G137800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G137800 chr4D 100.000 3530 0 0 1 3530 123348129 123351658 0.000000e+00 6519.0
1 TraesCS4D01G137800 chr4D 97.822 3536 70 5 1 3530 134977428 134980962 0.000000e+00 6096.0
2 TraesCS4D01G137800 chr4D 96.545 3531 108 9 1 3530 240996763 240993246 0.000000e+00 5832.0
3 TraesCS4D01G137800 chr5D 97.875 3529 69 6 3 3530 301052409 301055932 0.000000e+00 6096.0
4 TraesCS4D01G137800 chr7B 98.668 3304 42 2 1 3303 742950731 742947429 0.000000e+00 5856.0
5 TraesCS4D01G137800 chr7B 98.213 3302 55 4 1 3300 716782614 716785913 0.000000e+00 5768.0
6 TraesCS4D01G137800 chr7A 98.638 3304 43 2 1 3303 60170760 60167458 0.000000e+00 5851.0
7 TraesCS4D01G137800 chr7A 96.396 111 4 0 3296 3406 60327736 60327626 2.160000e-42 183.0
8 TraesCS4D01G137800 chr7A 96.396 111 4 0 3296 3406 571648709 571648819 2.160000e-42 183.0
9 TraesCS4D01G137800 chr2A 98.667 3302 41 3 1 3300 755478555 755481855 0.000000e+00 5851.0
10 TraesCS4D01G137800 chr5A 98.455 3301 48 3 1 3300 420183710 420187008 0.000000e+00 5810.0
11 TraesCS4D01G137800 chr5A 89.091 110 12 0 3388 3497 667844781 667844890 1.710000e-28 137.0
12 TraesCS4D01G137800 chr6A 97.977 3312 64 3 1 3310 155855306 155858616 0.000000e+00 5742.0
13 TraesCS4D01G137800 chr6B 91.632 239 14 3 3296 3530 606986076 606986312 3.400000e-85 326.0
14 TraesCS4D01G137800 chr6B 96.396 111 4 0 3296 3406 264839903 264839793 2.160000e-42 183.0
15 TraesCS4D01G137800 chr6B 96.396 111 4 0 3296 3406 596656033 596655923 2.160000e-42 183.0
16 TraesCS4D01G137800 chr6B 92.079 101 8 0 3425 3525 633597127 633597027 3.670000e-30 143.0
17 TraesCS4D01G137800 chr3B 91.156 147 11 1 3335 3481 724629727 724629871 7.730000e-47 198.0
18 TraesCS4D01G137800 chr3A 92.784 97 7 0 3401 3497 653796399 653796495 1.320000e-29 141.0
19 TraesCS4D01G137800 chr3A 91.379 58 5 0 3401 3458 495091967 495092024 2.920000e-11 80.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G137800 chr4D 123348129 123351658 3529 False 6519 6519 100.000 1 3530 1 chr4D.!!$F1 3529
1 TraesCS4D01G137800 chr4D 134977428 134980962 3534 False 6096 6096 97.822 1 3530 1 chr4D.!!$F2 3529
2 TraesCS4D01G137800 chr4D 240993246 240996763 3517 True 5832 5832 96.545 1 3530 1 chr4D.!!$R1 3529
3 TraesCS4D01G137800 chr5D 301052409 301055932 3523 False 6096 6096 97.875 3 3530 1 chr5D.!!$F1 3527
4 TraesCS4D01G137800 chr7B 742947429 742950731 3302 True 5856 5856 98.668 1 3303 1 chr7B.!!$R1 3302
5 TraesCS4D01G137800 chr7B 716782614 716785913 3299 False 5768 5768 98.213 1 3300 1 chr7B.!!$F1 3299
6 TraesCS4D01G137800 chr7A 60167458 60170760 3302 True 5851 5851 98.638 1 3303 1 chr7A.!!$R1 3302
7 TraesCS4D01G137800 chr2A 755478555 755481855 3300 False 5851 5851 98.667 1 3300 1 chr2A.!!$F1 3299
8 TraesCS4D01G137800 chr5A 420183710 420187008 3298 False 5810 5810 98.455 1 3300 1 chr5A.!!$F1 3299
9 TraesCS4D01G137800 chr6A 155855306 155858616 3310 False 5742 5742 97.977 1 3310 1 chr6A.!!$F1 3309

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
727 732 2.552373 GGAATCTCGGTCTTGTTTGGGT 60.552 50.0 0.0 0.0 0.00 4.51 F
1758 1763 0.185901 TTCTGGCCCCATATTCAGGC 59.814 55.0 0.0 0.0 46.37 4.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2211 2216 0.539438 ACCCAAATTGAGCGAAGGCA 60.539 50.0 0.00 0.0 43.41 4.75 R
3294 3299 0.179000 AGGCCATCATCGACCAAGAC 59.821 55.0 5.01 0.0 0.00 3.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
163 165 2.736721 CAAGTGTCACCAAGGATACACG 59.263 50.000 16.88 6.32 45.34 4.49
641 646 7.022979 CGAAATACAGTTGCTCAATTCATTCA 58.977 34.615 0.00 0.00 0.00 2.57
727 732 2.552373 GGAATCTCGGTCTTGTTTGGGT 60.552 50.000 0.00 0.00 0.00 4.51
793 798 5.247862 AGTAAATCGTTTTCGGTATGGGTT 58.752 37.500 0.00 0.00 44.25 4.11
1271 1276 7.655328 CGCTATTAAAGAAGGAGATCTTGTCAT 59.345 37.037 0.00 0.00 39.54 3.06
1403 1408 2.865343 AGACGTGTCGAAGTGAAAGT 57.135 45.000 0.00 0.00 34.09 2.66
1413 1418 2.716217 GAAGTGAAAGTCCCAGGGATG 58.284 52.381 12.84 0.00 32.73 3.51
1557 1562 9.958234 ACTGCAATAGCTATCGATACTATATTG 57.042 33.333 21.59 21.59 42.74 1.90
1758 1763 0.185901 TTCTGGCCCCATATTCAGGC 59.814 55.000 0.00 0.00 46.37 4.85
1798 1803 3.274095 TCCGTGATAATGGAATGCACA 57.726 42.857 0.00 0.00 0.00 4.57
2119 2124 4.814234 CAGCTATTAACGTTGGCTTATCCA 59.186 41.667 11.99 0.00 44.85 3.41
2256 2261 3.260483 GATGCTGCGACTCAGGCG 61.260 66.667 0.00 0.00 43.06 5.52
2374 2379 1.204704 TCAACGGCTTCTGTGATCGAT 59.795 47.619 0.00 0.00 0.00 3.59
2558 2563 4.227618 AGGTTGCCCCTTACTCGT 57.772 55.556 0.00 0.00 42.73 4.18
2975 2980 5.638596 AGGAAAAACGTGACAAGAAAAGT 57.361 34.783 0.00 0.00 0.00 2.66
3024 3029 3.202906 GTGCTAAATCAATAGGTGCCGA 58.797 45.455 0.00 0.00 0.00 5.54
3393 3398 3.005472 GGGAGTAACCACTTTTGAAAGGC 59.995 47.826 8.23 0.00 41.20 4.35
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
163 165 3.877508 CACAGGCCTATTTAGTAAGTGGC 59.122 47.826 3.98 11.90 35.86 5.01
616 621 7.022979 TGAATGAATTGAGCAACTGTATTTCG 58.977 34.615 0.00 0.00 0.00 3.46
727 732 2.376109 AGGCTCTCGTTAAGGAATCGA 58.624 47.619 0.00 0.00 0.00 3.59
1271 1276 1.655484 CACAATAGATCCAGTGCGCA 58.345 50.000 5.66 5.66 0.00 6.09
1403 1408 1.285280 ACGTTCAATCATCCCTGGGA 58.715 50.000 19.69 19.69 35.55 4.37
1413 1418 4.081761 CGTGCACAGATTTACGTTCAATC 58.918 43.478 18.64 10.71 0.00 2.67
1510 1515 3.662759 TTTTCCAGTTTGTCTGTCCCT 57.337 42.857 0.00 0.00 42.19 4.20
1557 1562 5.234972 CCTTGAGTTCATTTGCTTTTGGTTC 59.765 40.000 0.00 0.00 0.00 3.62
1758 1763 4.570597 GGAAATATTCCCCCATGGCACAG 61.571 52.174 6.09 0.00 43.46 3.66
2069 2074 4.585955 ATTCCGCGATAAAAGAGCTCTA 57.414 40.909 18.59 0.95 0.00 2.43
2119 2124 2.750637 AGACCCGACGCGACTGAT 60.751 61.111 15.93 0.00 0.00 2.90
2146 2151 5.388944 GCAGACTTGTTTCATAGCTTTCAG 58.611 41.667 0.00 0.00 0.00 3.02
2203 2208 2.670934 AGCGAAGGCAGCCACTTG 60.671 61.111 15.80 5.27 43.41 3.16
2211 2216 0.539438 ACCCAAATTGAGCGAAGGCA 60.539 50.000 0.00 0.00 43.41 4.75
2256 2261 3.623510 GCCTTGCACCTCTATTGAGTAAC 59.376 47.826 3.47 0.00 38.61 2.50
2374 2379 5.227569 TGAGAAATTCTGTCTAGTGGCAA 57.772 39.130 0.00 0.00 0.00 4.52
2558 2563 6.405953 CGAGAAAAGCCTTCTTCCTACATCTA 60.406 42.308 0.51 0.00 0.00 1.98
3291 3296 2.292267 GCCATCATCGACCAAGACAAT 58.708 47.619 0.00 0.00 0.00 2.71
3294 3299 0.179000 AGGCCATCATCGACCAAGAC 59.821 55.000 5.01 0.00 0.00 3.01
3474 3479 5.662657 CCCCCATTGATAAAAACCAGAATCT 59.337 40.000 0.00 0.00 0.00 2.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.