Multiple sequence alignment - TraesCS4D01G137700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G137700 chr4D 100.000 2231 0 0 1 2231 123337144 123339374 0.000000e+00 4120.0
1 TraesCS4D01G137700 chr4D 97.721 2238 33 5 1 2231 123551599 123553825 0.000000e+00 3834.0
2 TraesCS4D01G137700 chr4D 94.637 317 16 1 1886 2201 123351553 123351869 7.160000e-135 490.0
3 TraesCS4D01G137700 chr7D 99.267 1500 10 1 1 1499 382051752 382053251 0.000000e+00 2708.0
4 TraesCS4D01G137700 chr7D 99.200 1500 11 1 1 1499 381925674 381927173 0.000000e+00 2702.0
5 TraesCS4D01G137700 chr7D 99.067 1500 13 1 1 1499 203501672 203503171 0.000000e+00 2691.0
6 TraesCS4D01G137700 chr7D 98.804 1505 12 2 1 1499 381972097 381970593 0.000000e+00 2675.0
7 TraesCS4D01G137700 chr7D 94.318 440 20 2 1490 1929 300075233 300074799 0.000000e+00 669.0
8 TraesCS4D01G137700 chr7D 95.268 317 14 1 1886 2201 382028766 382028450 3.310000e-138 501.0
9 TraesCS4D01G137700 chr5A 99.267 1500 10 1 1 1499 19247170 19245671 0.000000e+00 2708.0
10 TraesCS4D01G137700 chr5A 98.533 1500 21 1 1 1499 238821135 238819636 0.000000e+00 2647.0
11 TraesCS4D01G137700 chr6D 98.934 1501 14 2 1 1499 124519195 124520695 0.000000e+00 2682.0
12 TraesCS4D01G137700 chr6D 95.238 441 15 4 1490 1929 430477635 430477200 0.000000e+00 693.0
13 TraesCS4D01G137700 chr6D 93.987 316 19 0 1886 2201 370023935 370024250 1.550000e-131 479.0
14 TraesCS4D01G137700 chr6D 97.436 39 1 0 2192 2230 350679783 350679821 1.430000e-07 67.6
15 TraesCS4D01G137700 chr7A 98.667 1500 14 2 1 1499 60280986 60282480 0.000000e+00 2654.0
16 TraesCS4D01G137700 chrUn 99.192 743 5 1 1490 2231 296253206 296252464 0.000000e+00 1338.0
17 TraesCS4D01G137700 chrUn 94.785 441 17 4 1490 1929 319760159 319759724 0.000000e+00 682.0
18 TraesCS4D01G137700 chr2D 98.611 432 5 1 1801 2231 322923514 322923083 0.000000e+00 763.0
19 TraesCS4D01G137700 chr2D 95.465 441 14 4 1490 1929 634991053 634990618 0.000000e+00 699.0
20 TraesCS4D01G137700 chr2D 100.000 34 0 0 2198 2231 39568026 39567993 1.850000e-06 63.9
21 TraesCS4D01G137700 chr6B 95.909 440 17 1 1793 2231 633597220 633596781 0.000000e+00 712.0
22 TraesCS4D01G137700 chr2B 95.701 442 16 1 1793 2231 391254099 391254540 0.000000e+00 708.0
23 TraesCS4D01G137700 chr1D 95.692 441 13 4 1490 1929 141348989 141349424 0.000000e+00 704.0
24 TraesCS4D01G137700 chr3B 94.331 441 19 4 1490 1929 756073236 756073671 0.000000e+00 671.0
25 TraesCS4D01G137700 chr5D 93.878 441 21 3 1490 1929 555228124 555228559 0.000000e+00 660.0
26 TraesCS4D01G137700 chr5D 90.529 359 26 6 1845 2201 80017071 80016719 3.350000e-128 468.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G137700 chr4D 123337144 123339374 2230 False 4120 4120 100.000 1 2231 1 chr4D.!!$F1 2230
1 TraesCS4D01G137700 chr4D 123551599 123553825 2226 False 3834 3834 97.721 1 2231 1 chr4D.!!$F3 2230
2 TraesCS4D01G137700 chr7D 382051752 382053251 1499 False 2708 2708 99.267 1 1499 1 chr7D.!!$F3 1498
3 TraesCS4D01G137700 chr7D 381925674 381927173 1499 False 2702 2702 99.200 1 1499 1 chr7D.!!$F2 1498
4 TraesCS4D01G137700 chr7D 203501672 203503171 1499 False 2691 2691 99.067 1 1499 1 chr7D.!!$F1 1498
5 TraesCS4D01G137700 chr7D 381970593 381972097 1504 True 2675 2675 98.804 1 1499 1 chr7D.!!$R2 1498
6 TraesCS4D01G137700 chr5A 19245671 19247170 1499 True 2708 2708 99.267 1 1499 1 chr5A.!!$R1 1498
7 TraesCS4D01G137700 chr5A 238819636 238821135 1499 True 2647 2647 98.533 1 1499 1 chr5A.!!$R2 1498
8 TraesCS4D01G137700 chr6D 124519195 124520695 1500 False 2682 2682 98.934 1 1499 1 chr6D.!!$F1 1498
9 TraesCS4D01G137700 chr7A 60280986 60282480 1494 False 2654 2654 98.667 1 1499 1 chr7A.!!$F1 1498
10 TraesCS4D01G137700 chrUn 296252464 296253206 742 True 1338 1338 99.192 1490 2231 1 chrUn.!!$R1 741

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
140 141 0.61782 ATACTGAGGTGCTCCCCGTT 60.618 55.0 0.0 0.0 0.0 4.44 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1717 1729 3.023832 TGAGATCAGAACTCATACCGCA 58.976 45.455 6.29 0.0 39.1 5.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
140 141 0.617820 ATACTGAGGTGCTCCCCGTT 60.618 55.000 0.00 0.00 0.00 4.44
1096 1107 3.372206 AGAATCATCTTGAAAACGCTCCG 59.628 43.478 0.00 0.00 29.15 4.63
1221 1233 1.906824 TGCGGTTCGGAGAGGACTT 60.907 57.895 0.00 0.00 38.43 3.01
1384 1396 6.402222 ACTACTAGCAATGACTTCCTCTTTG 58.598 40.000 0.00 0.00 37.19 2.77
1422 1434 2.544844 TATCCCTCTCCCTTGTTCGT 57.455 50.000 0.00 0.00 0.00 3.85
1430 1442 4.238514 CTCTCCCTTGTTCGTTCTTACTG 58.761 47.826 0.00 0.00 0.00 2.74
1658 1670 5.753438 TGAAATAAGTTGATAGCGCGATCTT 59.247 36.000 27.21 17.36 0.00 2.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
140 141 2.526993 CGCGTCGTTCCAACAACCA 61.527 57.895 0.00 0.00 0.00 3.67
764 774 0.608035 GACGATTGAAGCCCCCAACA 60.608 55.000 0.00 0.00 0.00 3.33
1221 1233 4.614967 AGGGGGTACTAACTAACAGCTA 57.385 45.455 0.00 0.00 0.00 3.32
1384 1396 7.694093 AGGGATATGGAAAGGATGAAGTAATC 58.306 38.462 0.00 0.00 0.00 1.75
1422 1434 5.559770 TGAGTGCCATTTGATCAGTAAGAA 58.440 37.500 0.00 0.00 0.00 2.52
1430 1442 4.978083 ATGAACTGAGTGCCATTTGATC 57.022 40.909 0.00 0.00 0.00 2.92
1717 1729 3.023832 TGAGATCAGAACTCATACCGCA 58.976 45.455 6.29 0.00 39.10 5.69
2134 2148 3.575247 TGCCCACGGTCCCACATT 61.575 61.111 0.00 0.00 0.00 2.71
2159 2174 2.747855 CGGGCAGGACTTTCCAGC 60.748 66.667 1.07 1.07 46.89 4.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.