Multiple sequence alignment - TraesCS4D01G137400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G137400 chr4D 100.000 4002 0 0 1 4002 123317925 123321926 0 7391
1 TraesCS4D01G137400 chrUn 98.752 4005 22 9 1 4002 206781122 206785101 0 7094
2 TraesCS4D01G137400 chr7A 98.526 4003 32 8 1 4002 60261778 60265754 0 7040
3 TraesCS4D01G137400 chr7A 97.927 4004 56 14 1 4002 120858674 120854696 0 6909
4 TraesCS4D01G137400 chr3B 97.881 4011 57 9 1 4002 483383167 483387158 0 6911
5 TraesCS4D01G137400 chr3B 97.706 4010 68 10 1 4002 669798066 669794073 0 6874
6 TraesCS4D01G137400 chr6B 96.982 4009 96 14 1 4002 297455579 297459569 0 6709
7 TraesCS4D01G137400 chr6B 98.613 3244 31 5 1 3244 394456103 394459332 0 5729
8 TraesCS4D01G137400 chr2B 98.569 3144 38 5 860 4002 391093547 391090410 0 5550
9 TraesCS4D01G137400 chr5A 98.162 3102 41 7 908 4002 238849203 238846111 0 5398
10 TraesCS4D01G137400 chr7D 99.398 1163 2 3 1 1161 336509533 336508374 0 2104


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G137400 chr4D 123317925 123321926 4001 False 7391 7391 100.000 1 4002 1 chr4D.!!$F1 4001
1 TraesCS4D01G137400 chrUn 206781122 206785101 3979 False 7094 7094 98.752 1 4002 1 chrUn.!!$F1 4001
2 TraesCS4D01G137400 chr7A 60261778 60265754 3976 False 7040 7040 98.526 1 4002 1 chr7A.!!$F1 4001
3 TraesCS4D01G137400 chr7A 120854696 120858674 3978 True 6909 6909 97.927 1 4002 1 chr7A.!!$R1 4001
4 TraesCS4D01G137400 chr3B 483383167 483387158 3991 False 6911 6911 97.881 1 4002 1 chr3B.!!$F1 4001
5 TraesCS4D01G137400 chr3B 669794073 669798066 3993 True 6874 6874 97.706 1 4002 1 chr3B.!!$R1 4001
6 TraesCS4D01G137400 chr6B 297455579 297459569 3990 False 6709 6709 96.982 1 4002 1 chr6B.!!$F1 4001
7 TraesCS4D01G137400 chr6B 394456103 394459332 3229 False 5729 5729 98.613 1 3244 1 chr6B.!!$F2 3243
8 TraesCS4D01G137400 chr2B 391090410 391093547 3137 True 5550 5550 98.569 860 4002 1 chr2B.!!$R1 3142
9 TraesCS4D01G137400 chr5A 238846111 238849203 3092 True 5398 5398 98.162 908 4002 1 chr5A.!!$R1 3094
10 TraesCS4D01G137400 chr7D 336508374 336509533 1159 True 2104 2104 99.398 1 1161 1 chr7D.!!$R1 1160

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
691 695 1.869767 CTAATTGATGAGGCCGACTGC 59.130 52.381 0.00 0.0 40.16 4.40 F
1200 1210 2.098934 TCGCGCTTTATGGCATTTCAAT 59.901 40.909 4.78 0.0 0.00 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2552 2571 0.179097 TGCAAGTTTCCCCGCAAAAC 60.179 50.000 0.00 0.00 36.97 2.43 R
3015 3034 1.268234 CCGAGAATTGCATTTCCGCTC 60.268 52.381 15.83 7.96 0.00 5.03 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
688 692 3.179443 TGACTAATTGATGAGGCCGAC 57.821 47.619 0.00 0.0 0.00 4.79
689 693 2.766263 TGACTAATTGATGAGGCCGACT 59.234 45.455 0.00 0.0 0.00 4.18
690 694 3.126831 GACTAATTGATGAGGCCGACTG 58.873 50.000 0.00 0.0 0.00 3.51
691 695 1.869767 CTAATTGATGAGGCCGACTGC 59.130 52.381 0.00 0.0 40.16 4.40
776 785 6.147437 TGGTATCCAGGTTCACCTATTTTT 57.853 37.500 0.00 0.0 46.65 1.94
798 807 4.442375 TTTTTCCGTTGTTGCTCTTCAA 57.558 36.364 0.00 0.0 0.00 2.69
1200 1210 2.098934 TCGCGCTTTATGGCATTTCAAT 59.901 40.909 4.78 0.0 0.00 2.57
2034 2045 5.772393 ATGATCTAGATAGACTCCGTCCT 57.228 43.478 4.89 0.0 34.72 3.85
2035 2046 5.570205 TGATCTAGATAGACTCCGTCCTT 57.430 43.478 4.89 0.0 34.72 3.36
2552 2571 1.658686 AAGAGTAGGCGTGGAGAGCG 61.659 60.000 0.00 0.0 35.00 5.03
3015 3034 0.037734 AACTAAACCGGGGAAGCTGG 59.962 55.000 6.32 0.0 0.00 4.85
3320 3339 1.153168 GCGATAGGAAGCCAAGCCA 60.153 57.895 0.00 0.0 0.00 4.75
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
688 692 3.312973 CCTCGTGAGTACTACTTAGGCAG 59.687 52.174 0.00 0.00 0.00 4.85
689 693 3.276857 CCTCGTGAGTACTACTTAGGCA 58.723 50.000 0.00 0.00 0.00 4.75
690 694 3.277715 ACCTCGTGAGTACTACTTAGGC 58.722 50.000 11.76 0.00 0.00 3.93
691 695 3.876320 GGACCTCGTGAGTACTACTTAGG 59.124 52.174 0.00 3.84 0.00 2.69
777 786 4.442375 TTGAAGAGCAACAACGGAAAAA 57.558 36.364 0.00 0.00 0.00 1.94
798 807 7.217070 CGAAGACTACTTACTATACGCGTTTTT 59.783 37.037 20.78 5.57 36.39 1.94
1200 1210 4.016444 GTGGGATTGGATTAGTTTGCTCA 58.984 43.478 0.00 0.00 0.00 4.26
2552 2571 0.179097 TGCAAGTTTCCCCGCAAAAC 60.179 50.000 0.00 0.00 36.97 2.43
3015 3034 1.268234 CCGAGAATTGCATTTCCGCTC 60.268 52.381 15.83 7.96 0.00 5.03
3320 3339 1.815003 CTGCTCGCCTTTCCTTTTGAT 59.185 47.619 0.00 0.00 0.00 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.