Multiple sequence alignment - TraesCS4D01G137200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G137200 chr4D 100.000 2246 0 0 1 2246 123287911 123290156 0 4148
1 TraesCS4D01G137200 chr4D 99.158 1663 12 2 585 2246 123320264 123321925 0 2992
2 TraesCS4D01G137200 chr4D 97.470 593 12 3 1 590 205132552 205133144 0 1009
3 TraesCS4D01G137200 chr4D 96.934 587 13 5 1 584 140385567 140384983 0 979
4 TraesCS4D01G137200 chr4D 96.115 592 19 4 1 591 124116048 124115460 0 963
5 TraesCS4D01G137200 chr4D 96.068 585 22 1 1 584 322077556 322076972 0 952
6 TraesCS4D01G137200 chrUn 99.159 1664 12 2 585 2246 206783437 206785100 0 2994
7 TraesCS4D01G137200 chrUn 98.978 1664 14 2 586 2246 86515920 86517583 0 2976
8 TraesCS4D01G137200 chrUn 98.857 1663 17 2 585 2246 345389861 345388200 0 2964
9 TraesCS4D01G137200 chr6D 99.158 1663 10 4 585 2246 124502315 124503974 0 2990
10 TraesCS4D01G137200 chr6D 96.410 585 18 3 1 584 3947944 3947362 0 961
11 TraesCS4D01G137200 chr6D 96.404 584 15 2 1 584 134404999 134404422 0 957
12 TraesCS4D01G137200 chr7A 98.857 1663 17 2 585 2246 60264092 60265753 0 2964
13 TraesCS4D01G137200 chr2B 98.617 1663 22 1 585 2246 391092073 391090411 0 2942
14 TraesCS4D01G137200 chr1B 98.677 1663 15 4 585 2246 672569311 672567655 0 2942
15 TraesCS4D01G137200 chr5A 98.497 1663 21 4 585 2246 238847771 238846112 0 2929
16 TraesCS4D01G137200 chr5D 96.239 585 17 4 1 584 370272964 370273544 0 953
17 TraesCS4D01G137200 chr5D 96.068 585 18 4 1 584 370265098 370265678 0 948
18 TraesCS4D01G137200 chr3D 95.630 595 16 7 1 591 489104873 489104285 0 946


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G137200 chr4D 123287911 123290156 2245 False 4148 4148 100.000 1 2246 1 chr4D.!!$F1 2245
1 TraesCS4D01G137200 chr4D 123320264 123321925 1661 False 2992 2992 99.158 585 2246 1 chr4D.!!$F2 1661
2 TraesCS4D01G137200 chr4D 205132552 205133144 592 False 1009 1009 97.470 1 590 1 chr4D.!!$F3 589
3 TraesCS4D01G137200 chr4D 140384983 140385567 584 True 979 979 96.934 1 584 1 chr4D.!!$R2 583
4 TraesCS4D01G137200 chr4D 124115460 124116048 588 True 963 963 96.115 1 591 1 chr4D.!!$R1 590
5 TraesCS4D01G137200 chr4D 322076972 322077556 584 True 952 952 96.068 1 584 1 chr4D.!!$R3 583
6 TraesCS4D01G137200 chrUn 206783437 206785100 1663 False 2994 2994 99.159 585 2246 1 chrUn.!!$F2 1661
7 TraesCS4D01G137200 chrUn 86515920 86517583 1663 False 2976 2976 98.978 586 2246 1 chrUn.!!$F1 1660
8 TraesCS4D01G137200 chrUn 345388200 345389861 1661 True 2964 2964 98.857 585 2246 1 chrUn.!!$R1 1661
9 TraesCS4D01G137200 chr6D 124502315 124503974 1659 False 2990 2990 99.158 585 2246 1 chr6D.!!$F1 1661
10 TraesCS4D01G137200 chr6D 3947362 3947944 582 True 961 961 96.410 1 584 1 chr6D.!!$R1 583
11 TraesCS4D01G137200 chr6D 134404422 134404999 577 True 957 957 96.404 1 584 1 chr6D.!!$R2 583
12 TraesCS4D01G137200 chr7A 60264092 60265753 1661 False 2964 2964 98.857 585 2246 1 chr7A.!!$F1 1661
13 TraesCS4D01G137200 chr2B 391090411 391092073 1662 True 2942 2942 98.617 585 2246 1 chr2B.!!$R1 1661
14 TraesCS4D01G137200 chr1B 672567655 672569311 1656 True 2942 2942 98.677 585 2246 1 chr1B.!!$R1 1661
15 TraesCS4D01G137200 chr5A 238846112 238847771 1659 True 2929 2929 98.497 585 2246 1 chr5A.!!$R1 1661
16 TraesCS4D01G137200 chr5D 370272964 370273544 580 False 953 953 96.239 1 584 1 chr5D.!!$F2 583
17 TraesCS4D01G137200 chr5D 370265098 370265678 580 False 948 948 96.068 1 584 1 chr5D.!!$F1 583
18 TraesCS4D01G137200 chr3D 489104285 489104873 588 True 946 946 95.630 1 591 1 chr3D.!!$R1 590

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
42 43 2.646175 CCGTGCGGGAAGAGGAAGA 61.646 63.158 2.15 0.0 38.47 2.87 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1285 1298 1.925455 CCTGGAGCTTCCCCCTTCA 60.925 63.158 0.0 0.0 35.03 3.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
42 43 2.646175 CCGTGCGGGAAGAGGAAGA 61.646 63.158 2.15 0.0 38.47 2.87
346 353 7.454380 TCCTCCAGTATTTCAATTGTTTTGGAT 59.546 33.333 5.13 0.0 32.30 3.41
711 723 2.674754 GGGCCTTCGATTCCACCA 59.325 61.111 0.84 0.0 0.00 4.17
1285 1298 2.496899 AATGCAATTCTCGGGTGAGT 57.503 45.000 0.00 0.0 43.09 3.41
1966 1979 4.281941 CCCCTTATCTCTTCATCATCGTCA 59.718 45.833 0.00 0.0 0.00 4.35
2122 2135 5.471797 CCCTCTCTTCCTTTTTGAGAAAGAC 59.528 44.000 0.00 0.0 36.56 3.01
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
175 179 6.246163 AGATTTTCTAACAAGACGGGGAAAT 58.754 36.000 0.00 0.0 0.00 2.17
187 191 9.886132 GTTCACCCTATTCTAGATTTTCTAACA 57.114 33.333 0.00 0.0 0.00 2.41
414 421 8.661352 ATTTGATTTTTCAAACGAGGATTGTT 57.339 26.923 3.46 0.0 46.93 2.83
711 723 3.435313 CCTCTATGAGACCGTAAGACCCT 60.435 52.174 0.00 0.0 43.02 4.34
1285 1298 1.925455 CCTGGAGCTTCCCCCTTCA 60.925 63.158 0.00 0.0 35.03 3.02
1966 1979 3.660865 GAATACCACAAGTGACGGAACT 58.339 45.455 0.94 0.0 0.00 3.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.