Multiple sequence alignment - TraesCS4D01G116100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G116100 chr4D 100.000 2447 0 0 1 2447 97360978 97363424 0.000000e+00 4519
1 TraesCS4D01G116100 chr4D 95.796 2450 98 2 3 2447 241247493 241249942 0.000000e+00 3949
2 TraesCS4D01G116100 chr4D 95.785 2254 76 5 1 2253 241310192 241312427 0.000000e+00 3618
3 TraesCS4D01G116100 chr4D 97.132 802 18 1 1 802 135047392 135048188 0.000000e+00 1349
4 TraesCS4D01G116100 chr6D 98.489 2449 35 2 1 2447 430467625 430465177 0.000000e+00 4316
5 TraesCS4D01G116100 chr6D 97.579 1941 42 3 137 2076 370001600 369999664 0.000000e+00 3319
6 TraesCS4D01G116100 chr3D 97.844 2458 42 3 1 2447 202626331 202623874 0.000000e+00 4235
7 TraesCS4D01G116100 chr3D 96.989 1860 56 0 588 2447 498443578 498445437 0.000000e+00 3125
8 TraesCS4D01G116100 chr1D 97.386 2448 63 1 1 2447 350976829 350979276 0.000000e+00 4165
9 TraesCS4D01G116100 chr5D 96.605 2445 71 3 3 2447 80104918 80102486 0.000000e+00 4045
10 TraesCS4D01G116100 chr5A 97.760 1607 35 1 842 2447 162145416 162143810 0.000000e+00 2767
11 TraesCS4D01G116100 chr5A 98.000 100 2 0 2207 2306 55022084 55022183 8.990000e-40 174
12 TraesCS4D01G116100 chrUn 97.899 1428 20 2 1 1418 275334265 275335692 0.000000e+00 2462
13 TraesCS4D01G116100 chr4A 95.385 1170 49 1 1 1170 295191742 295190578 0.000000e+00 1857
14 TraesCS4D01G116100 chr4A 95.600 841 36 1 1 841 350192177 350191338 0.000000e+00 1347
15 TraesCS4D01G116100 chr2B 96.053 76 3 0 2302 2377 716503673 716503598 9.190000e-25 124


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G116100 chr4D 97360978 97363424 2446 False 4519 4519 100.000 1 2447 1 chr4D.!!$F1 2446
1 TraesCS4D01G116100 chr4D 241247493 241249942 2449 False 3949 3949 95.796 3 2447 1 chr4D.!!$F3 2444
2 TraesCS4D01G116100 chr4D 241310192 241312427 2235 False 3618 3618 95.785 1 2253 1 chr4D.!!$F4 2252
3 TraesCS4D01G116100 chr4D 135047392 135048188 796 False 1349 1349 97.132 1 802 1 chr4D.!!$F2 801
4 TraesCS4D01G116100 chr6D 430465177 430467625 2448 True 4316 4316 98.489 1 2447 1 chr6D.!!$R2 2446
5 TraesCS4D01G116100 chr6D 369999664 370001600 1936 True 3319 3319 97.579 137 2076 1 chr6D.!!$R1 1939
6 TraesCS4D01G116100 chr3D 202623874 202626331 2457 True 4235 4235 97.844 1 2447 1 chr3D.!!$R1 2446
7 TraesCS4D01G116100 chr3D 498443578 498445437 1859 False 3125 3125 96.989 588 2447 1 chr3D.!!$F1 1859
8 TraesCS4D01G116100 chr1D 350976829 350979276 2447 False 4165 4165 97.386 1 2447 1 chr1D.!!$F1 2446
9 TraesCS4D01G116100 chr5D 80102486 80104918 2432 True 4045 4045 96.605 3 2447 1 chr5D.!!$R1 2444
10 TraesCS4D01G116100 chr5A 162143810 162145416 1606 True 2767 2767 97.760 842 2447 1 chr5A.!!$R1 1605
11 TraesCS4D01G116100 chrUn 275334265 275335692 1427 False 2462 2462 97.899 1 1418 1 chrUn.!!$F1 1417
12 TraesCS4D01G116100 chr4A 295190578 295191742 1164 True 1857 1857 95.385 1 1170 1 chr4A.!!$R1 1169
13 TraesCS4D01G116100 chr4A 350191338 350192177 839 True 1347 1347 95.600 1 841 1 chr4A.!!$R2 840

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
915 946 0.036952 TCGGGAGCAGAGCTGAAAAG 60.037 55.0 0.85 0.0 39.88 2.27 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2190 2223 0.107703 TTGAATGATCGCTCCGGCTT 60.108 50.0 0.0 0.0 36.09 4.35 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
225 226 5.716979 AGGGTCATAGCTAGTTCAGGATTA 58.283 41.667 0.00 0.0 0.00 1.75
335 336 2.762535 ACGACTCGGTGATTCCATTT 57.237 45.000 2.98 0.0 35.57 2.32
360 361 2.180204 CCGGCCGCAAGATTCGATT 61.180 57.895 22.85 0.0 43.02 3.34
460 461 3.275999 GCCCGCCTTTTCTTGTAGAATA 58.724 45.455 0.00 0.0 33.67 1.75
551 552 1.206371 GCTAAACCGGGAGAGTTGCTA 59.794 52.381 6.32 0.0 0.00 3.49
915 946 0.036952 TCGGGAGCAGAGCTGAAAAG 60.037 55.000 0.85 0.0 39.88 2.27
924 955 3.618351 CAGAGCTGAAAAGGATGGACAT 58.382 45.455 0.00 0.0 0.00 3.06
985 1016 2.398554 GCGGCTTCCAATTGCTCGA 61.399 57.895 0.00 0.0 0.00 4.04
1126 1157 0.393402 TCACCGCCTAGCTCGAACTA 60.393 55.000 0.00 0.0 0.00 2.24
1208 1239 1.272769 GGTCAAAGTAGGAGTCGCAGT 59.727 52.381 0.00 0.0 0.00 4.40
1285 1316 0.690192 TCGTTGGATCCTTGGAGCAA 59.310 50.000 14.23 0.0 0.00 3.91
1294 1325 4.039124 GGATCCTTGGAGCAACTTTCAAAA 59.961 41.667 3.84 0.0 0.00 2.44
1375 1406 3.739401 ACCGAAAGAGGGGAATTTCAT 57.261 42.857 0.00 0.0 35.58 2.57
1501 1532 8.958119 TTCAGTCATACTCAACAAAAGTAAGT 57.042 30.769 0.00 0.0 33.19 2.24
1553 1584 7.279615 TCTTCATATAGAAAGAAAATCGGCCA 58.720 34.615 2.24 0.0 35.40 5.36
1739 1771 2.708861 TGAAGAAGTAGTGGGCCTTTCA 59.291 45.455 4.53 0.0 0.00 2.69
1764 1796 2.589798 TTTCGTTTGACTCGTGGAGT 57.410 45.000 0.00 0.0 46.42 3.85
2116 2149 0.465460 AACTTCGCCTTCACCAAGCA 60.465 50.000 0.00 0.0 0.00 3.91
2142 2175 6.327104 TGGGTTTTCACTAGTCCTAACTAACA 59.673 38.462 0.00 0.0 37.53 2.41
2190 2223 1.218047 CGAAGATCAGACGGCCCAA 59.782 57.895 0.00 0.0 0.00 4.12
2345 2382 3.274288 GAAGCTTCAGAAACCATCCGAT 58.726 45.455 21.67 0.0 0.00 4.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
335 336 0.827925 ATCTTGCGGCCGGATAGAGA 60.828 55.000 29.38 24.05 0.00 3.10
551 552 2.159296 GCGAAACTTTGAACCCAACACT 60.159 45.455 0.00 0.00 30.88 3.55
698 729 6.837992 TCTCTTATAACCAAACATCGCAAAC 58.162 36.000 0.00 0.00 0.00 2.93
915 946 1.455786 CGCGATCGTTAATGTCCATCC 59.544 52.381 17.81 0.00 0.00 3.51
985 1016 5.373854 AGTCCCCCATATAGCTGAGAATTTT 59.626 40.000 0.00 0.00 0.00 1.82
1126 1157 7.754625 ACCATAAGTTTTATTACATCGCGTTT 58.245 30.769 5.77 0.00 0.00 3.60
1208 1239 9.573166 CAATCCCAGGAACATCATAAATAGTAA 57.427 33.333 0.00 0.00 0.00 2.24
1285 1316 7.331193 CCTGTAGCTTATACGTCTTTTGAAAGT 59.669 37.037 0.00 0.00 37.31 2.66
1294 1325 6.005198 AGCTTATCCTGTAGCTTATACGTCT 58.995 40.000 0.00 0.00 45.03 4.18
1375 1406 4.435137 TGAAGATTCCCCCTTCTCTTACA 58.565 43.478 0.00 0.00 40.37 2.41
1501 1532 4.310022 AAAGGATCCGGGTCAAACATTA 57.690 40.909 18.43 0.00 0.00 1.90
1527 1558 7.442364 TGGCCGATTTTCTTTCTATATGAAGAG 59.558 37.037 0.00 0.00 35.89 2.85
1553 1584 3.663298 ATGAAGGGGGAGTATGAGGAT 57.337 47.619 0.00 0.00 0.00 3.24
1739 1771 3.744426 CCACGAGTCAAACGAAATAAGGT 59.256 43.478 0.00 0.00 34.70 3.50
1764 1796 7.235606 TCCCTCTCTTTGAAGTAGATTTCTCAA 59.764 37.037 0.00 0.00 0.00 3.02
2116 2149 7.016858 TGTTAGTTAGGACTAGTGAAAACCCAT 59.983 37.037 0.00 0.00 39.43 4.00
2129 2162 4.642429 CTTGCCAACTGTTAGTTAGGACT 58.358 43.478 11.66 0.00 36.03 3.85
2142 2175 1.271840 TAGGGGATCGCTTGCCAACT 61.272 55.000 9.90 0.00 37.63 3.16
2190 2223 0.107703 TTGAATGATCGCTCCGGCTT 60.108 50.000 0.00 0.00 36.09 4.35
2345 2382 7.014134 TGCAACATTTCTTGTTTCCAGAAGATA 59.986 33.333 0.00 0.00 46.51 1.98


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.