Multiple sequence alignment - TraesCS4D01G114800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G114800 chr4D 100.000 2348 0 0 1 2348 95782427 95780080 0.000000e+00 4337.0
1 TraesCS4D01G114800 chr4A 96.102 2386 43 12 1 2348 483950054 483952427 0.000000e+00 3845.0
2 TraesCS4D01G114800 chr4A 91.593 226 15 2 1263 1488 373805027 373804806 2.270000e-80 309.0
3 TraesCS4D01G114800 chr4A 91.593 226 15 2 1263 1488 606355417 606355196 2.270000e-80 309.0
4 TraesCS4D01G114800 chr4A 98.214 168 3 0 1657 1824 624286703 624286536 6.350000e-76 294.0
5 TraesCS4D01G114800 chr4A 100.000 30 0 0 1559 1588 624286731 624286702 3.260000e-04 56.5
6 TraesCS4D01G114800 chr4B 94.971 2068 58 10 1 2040 135212741 135210692 0.000000e+00 3201.0
7 TraesCS4D01G114800 chr4B 97.710 262 1 3 2090 2348 135210693 135210434 1.660000e-121 446.0
8 TraesCS4D01G114800 chr4B 96.471 170 4 1 1657 1824 211593256 211593425 1.780000e-71 279.0
9 TraesCS4D01G114800 chr4B 96.471 170 4 1 1657 1824 286753460 286753629 1.780000e-71 279.0
10 TraesCS4D01G114800 chr5A 82.915 597 73 20 912 1494 282587504 282588085 5.790000e-141 510.0
11 TraesCS4D01G114800 chr5A 92.478 226 13 2 1263 1488 598933576 598933355 1.050000e-83 320.0
12 TraesCS4D01G114800 chr5D 82.667 600 74 21 912 1494 214919244 214919830 2.690000e-139 505.0
13 TraesCS4D01G114800 chr2A 82.558 602 73 24 914 1493 706995616 706995025 3.480000e-138 501.0
14 TraesCS4D01G114800 chr2A 78.529 340 65 7 912 1247 645311753 645311418 1.410000e-52 217.0
15 TraesCS4D01G114800 chr2A 87.234 141 13 4 1726 1865 706994710 706994574 3.120000e-34 156.0
16 TraesCS4D01G114800 chr5B 82.412 597 77 20 912 1494 230248094 230248676 1.620000e-136 496.0
17 TraesCS4D01G114800 chr5B 96.471 170 4 1 1657 1824 36727351 36727182 1.780000e-71 279.0
18 TraesCS4D01G114800 chr2D 81.924 603 77 25 912 1493 567477709 567477118 4.540000e-132 481.0
19 TraesCS4D01G114800 chr2B 83.865 502 58 16 912 1399 680194375 680193883 7.650000e-125 457.0
20 TraesCS4D01G114800 chr7D 92.070 227 14 3 1262 1488 548559615 548559393 1.350000e-82 316.0
21 TraesCS4D01G114800 chr7A 92.035 226 14 2 1263 1488 663752055 663752276 4.870000e-82 315.0
22 TraesCS4D01G114800 chr7A 97.059 170 3 1 1657 1824 169392933 169392764 3.820000e-73 285.0
23 TraesCS4D01G114800 chr6B 92.070 227 13 2 1263 1488 60484936 60485158 4.870000e-82 315.0
24 TraesCS4D01G114800 chr1B 91.593 226 15 2 1263 1488 258836651 258836430 2.270000e-80 309.0
25 TraesCS4D01G114800 chr3B 97.059 170 3 1 1657 1824 327795691 327795860 3.820000e-73 285.0
26 TraesCS4D01G114800 chr1D 96.951 164 4 1 1628 1791 12646592 12646754 8.270000e-70 274.0
27 TraesCS4D01G114800 chr1D 97.368 38 1 0 1590 1627 12646536 12646573 5.420000e-07 65.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G114800 chr4D 95780080 95782427 2347 True 4337.0 4337 100.0000 1 2348 1 chr4D.!!$R1 2347
1 TraesCS4D01G114800 chr4A 483950054 483952427 2373 False 3845.0 3845 96.1020 1 2348 1 chr4A.!!$F1 2347
2 TraesCS4D01G114800 chr4B 135210434 135212741 2307 True 1823.5 3201 96.3405 1 2348 2 chr4B.!!$R1 2347
3 TraesCS4D01G114800 chr5A 282587504 282588085 581 False 510.0 510 82.9150 912 1494 1 chr5A.!!$F1 582
4 TraesCS4D01G114800 chr5D 214919244 214919830 586 False 505.0 505 82.6670 912 1494 1 chr5D.!!$F1 582
5 TraesCS4D01G114800 chr2A 706994574 706995616 1042 True 328.5 501 84.8960 914 1865 2 chr2A.!!$R2 951
6 TraesCS4D01G114800 chr5B 230248094 230248676 582 False 496.0 496 82.4120 912 1494 1 chr5B.!!$F1 582
7 TraesCS4D01G114800 chr2D 567477118 567477709 591 True 481.0 481 81.9240 912 1493 1 chr2D.!!$R1 581

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
988 1000 0.101579 TCTCAAAGTGCACGACGTCA 59.898 50.0 17.16 0.0 0.0 4.35 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1947 2163 1.102978 CAGGTAAAAATGGGAGGCCG 58.897 55.0 0.0 0.0 0.0 6.13 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
81 82 4.404394 TGGAAGACAAAAAGGGGAGAAAAC 59.596 41.667 0.00 0.00 0.00 2.43
113 114 1.061905 AGGGGCGATGAATGGATGGA 61.062 55.000 0.00 0.00 0.00 3.41
225 226 2.131183 GTGCATAGCAGCAGTAGTAGC 58.869 52.381 0.00 0.00 46.69 3.58
587 599 4.737177 GCTGGGCTGCAGCTCCTT 62.737 66.667 34.91 0.00 41.95 3.36
593 605 2.331132 GCTGCAGCTCCTTGTGTCC 61.331 63.158 31.33 0.00 38.21 4.02
673 685 5.412526 TGAAATGGTAACGTGTCTTGTTC 57.587 39.130 0.00 0.00 40.79 3.18
900 912 4.182433 TGGTGCCACTGCCGTTGA 62.182 61.111 0.00 0.00 36.33 3.18
906 918 2.562912 CACTGCCGTTGATGCACC 59.437 61.111 0.00 0.00 34.46 5.01
907 919 2.112928 ACTGCCGTTGATGCACCA 59.887 55.556 0.00 0.00 34.46 4.17
940 952 1.220206 CCTGCAGCCGATGAAGAGT 59.780 57.895 8.66 0.00 36.54 3.24
988 1000 0.101579 TCTCAAAGTGCACGACGTCA 59.898 50.000 17.16 0.00 0.00 4.35
1156 1174 2.273449 CCGCCAAGAGGGAAGCAT 59.727 61.111 0.00 0.00 40.01 3.79
1384 1411 2.731976 CGTGTTAGGCTCTTGTTGTCTC 59.268 50.000 0.00 0.00 0.00 3.36
1907 2123 3.054065 AGCTTCCCATTTCCTCTAACCAG 60.054 47.826 0.00 0.00 0.00 4.00
1947 2163 7.255625 GCTTTCCCATTCTATTTCCAAGTATCC 60.256 40.741 0.00 0.00 0.00 2.59
2030 2246 5.221204 TGCACTTTCAACTGAATAACATGCA 60.221 36.000 0.00 0.00 33.40 3.96
2031 2247 5.344128 GCACTTTCAACTGAATAACATGCAG 59.656 40.000 0.00 0.00 33.54 4.41
2032 2248 6.441274 CACTTTCAACTGAATAACATGCAGT 58.559 36.000 0.00 0.00 44.15 4.40
2033 2249 7.584108 CACTTTCAACTGAATAACATGCAGTA 58.416 34.615 0.16 0.00 41.65 2.74
2034 2250 7.747799 CACTTTCAACTGAATAACATGCAGTAG 59.252 37.037 0.16 0.00 41.65 2.57
2035 2251 7.445402 ACTTTCAACTGAATAACATGCAGTAGT 59.555 33.333 0.16 0.00 41.65 2.73
2036 2252 8.840833 TTTCAACTGAATAACATGCAGTAGTA 57.159 30.769 0.16 0.00 41.65 1.82
2037 2253 8.479313 TTCAACTGAATAACATGCAGTAGTAG 57.521 34.615 0.16 0.00 41.65 2.57
2038 2254 7.611770 TCAACTGAATAACATGCAGTAGTAGT 58.388 34.615 0.16 0.00 41.65 2.73
2106 2322 7.230027 TGGGTTGATAATTTGGCAGAAATTTT 58.770 30.769 10.05 4.13 32.64 1.82
2108 2324 9.225436 GGGTTGATAATTTGGCAGAAATTTTTA 57.775 29.630 10.05 0.00 32.64 1.52
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
81 82 3.726291 TCGCCCCTTTTCTTTTTCTTG 57.274 42.857 0.00 0.00 0.00 3.02
113 114 1.911454 TCTTCCATCCACCCATCCAT 58.089 50.000 0.00 0.00 0.00 3.41
225 226 1.354101 TTACTACCACCACCACCAGG 58.646 55.000 0.00 0.00 42.21 4.45
958 970 3.883744 CTTTGAGAGGGTGCGCGGT 62.884 63.158 8.83 0.00 0.00 5.68
973 985 3.713963 GGTGACGTCGTGCACTTT 58.286 55.556 16.19 0.00 35.43 2.66
988 1000 1.078143 GAAGCATCTGGAAGCCGGT 60.078 57.895 1.90 0.00 0.00 5.28
1156 1174 3.684990 AAGCAGCACGCCGAGAGA 61.685 61.111 0.00 0.00 44.04 3.10
1542 1608 2.113433 GCTGCTGAGCCCTCATGTG 61.113 63.158 0.23 0.00 39.57 3.21
1947 2163 1.102978 CAGGTAAAAATGGGAGGCCG 58.897 55.000 0.00 0.00 0.00 6.13
2030 2246 9.757227 CGGTCAATTACTACTACTACTACTACT 57.243 37.037 0.00 0.00 0.00 2.57
2031 2247 9.751542 TCGGTCAATTACTACTACTACTACTAC 57.248 37.037 0.00 0.00 0.00 2.73
2032 2248 9.751542 GTCGGTCAATTACTACTACTACTACTA 57.248 37.037 0.00 0.00 0.00 1.82
2033 2249 8.260818 TGTCGGTCAATTACTACTACTACTACT 58.739 37.037 0.00 0.00 0.00 2.57
2034 2250 8.425577 TGTCGGTCAATTACTACTACTACTAC 57.574 38.462 0.00 0.00 0.00 2.73
2035 2251 9.049523 CATGTCGGTCAATTACTACTACTACTA 57.950 37.037 0.00 0.00 0.00 1.82
2036 2252 7.772292 TCATGTCGGTCAATTACTACTACTACT 59.228 37.037 0.00 0.00 0.00 2.57
2037 2253 7.923888 TCATGTCGGTCAATTACTACTACTAC 58.076 38.462 0.00 0.00 0.00 2.73
2038 2254 8.565416 CATCATGTCGGTCAATTACTACTACTA 58.435 37.037 0.00 0.00 0.00 1.82
2111 2327 1.601166 AGCGGACCACAGGTTTAAAC 58.399 50.000 9.98 9.98 35.25 2.01
2113 2329 1.600023 CAAGCGGACCACAGGTTTAA 58.400 50.000 0.00 0.00 35.25 1.52
2116 2332 1.990160 TTCCAAGCGGACCACAGGTT 61.990 55.000 0.00 0.00 42.67 3.50


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.