Multiple sequence alignment - TraesCS4D01G110300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G110300 chr4D 100.000 2913 0 0 1 2913 90925162 90928074 0 5380
1 TraesCS4D01G110300 chr4D 98.415 757 11 1 2157 2913 485902829 485903584 0 1330
2 TraesCS4D01G110300 chr4D 98.283 757 12 1 2157 2913 67861478 67860723 0 1325
3 TraesCS4D01G110300 chr6D 97.175 2159 56 4 1 2156 52092700 52094856 0 3644
4 TraesCS4D01G110300 chr6D 97.130 2160 55 5 1 2156 123846576 123844420 0 3639
5 TraesCS4D01G110300 chr6D 96.944 2160 61 3 1 2156 89880007 89877849 0 3618
6 TraesCS4D01G110300 chr6D 98.283 757 12 1 2157 2913 319576100 319575345 0 1325
7 TraesCS4D01G110300 chr3D 97.083 2160 59 2 1 2156 555353542 555355701 0 3637
8 TraesCS4D01G110300 chr5D 97.083 2160 58 3 2 2156 315882157 315884316 0 3635
9 TraesCS4D01G110300 chr1D 97.040 2162 57 4 1 2156 215968170 215970330 0 3631
10 TraesCS4D01G110300 chr1D 96.992 2161 55 5 1 2156 433636398 433638553 0 3622
11 TraesCS4D01G110300 chr1D 96.942 2158 64 1 1 2156 292057317 292059474 0 3618
12 TraesCS4D01G110300 chr1D 98.415 757 11 1 2157 2913 400825115 400824360 0 1330
13 TraesCS4D01G110300 chr1D 98.285 758 11 2 2157 2913 433638601 433639357 0 1327
14 TraesCS4D01G110300 chr2D 97.034 2158 61 2 1 2156 572833072 572830916 0 3627
15 TraesCS4D01G110300 chr2D 98.543 755 10 1 2157 2911 267363290 267362537 0 1332
16 TraesCS4D01G110300 chr2D 98.283 757 13 0 2157 2913 533350066 533349310 0 1327
17 TraesCS4D01G110300 chr7D 98.547 757 9 1 2157 2913 354336393 354335639 0 1336
18 TraesCS4D01G110300 chr7D 98.415 757 11 1 2157 2913 417410262 417411017 0 1330


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G110300 chr4D 90925162 90928074 2912 False 5380.0 5380 100.0000 1 2913 1 chr4D.!!$F1 2912
1 TraesCS4D01G110300 chr4D 485902829 485903584 755 False 1330.0 1330 98.4150 2157 2913 1 chr4D.!!$F2 756
2 TraesCS4D01G110300 chr4D 67860723 67861478 755 True 1325.0 1325 98.2830 2157 2913 1 chr4D.!!$R1 756
3 TraesCS4D01G110300 chr6D 52092700 52094856 2156 False 3644.0 3644 97.1750 1 2156 1 chr6D.!!$F1 2155
4 TraesCS4D01G110300 chr6D 123844420 123846576 2156 True 3639.0 3639 97.1300 1 2156 1 chr6D.!!$R2 2155
5 TraesCS4D01G110300 chr6D 89877849 89880007 2158 True 3618.0 3618 96.9440 1 2156 1 chr6D.!!$R1 2155
6 TraesCS4D01G110300 chr6D 319575345 319576100 755 True 1325.0 1325 98.2830 2157 2913 1 chr6D.!!$R3 756
7 TraesCS4D01G110300 chr3D 555353542 555355701 2159 False 3637.0 3637 97.0830 1 2156 1 chr3D.!!$F1 2155
8 TraesCS4D01G110300 chr5D 315882157 315884316 2159 False 3635.0 3635 97.0830 2 2156 1 chr5D.!!$F1 2154
9 TraesCS4D01G110300 chr1D 215968170 215970330 2160 False 3631.0 3631 97.0400 1 2156 1 chr1D.!!$F1 2155
10 TraesCS4D01G110300 chr1D 292057317 292059474 2157 False 3618.0 3618 96.9420 1 2156 1 chr1D.!!$F2 2155
11 TraesCS4D01G110300 chr1D 433636398 433639357 2959 False 2474.5 3622 97.6385 1 2913 2 chr1D.!!$F3 2912
12 TraesCS4D01G110300 chr1D 400824360 400825115 755 True 1330.0 1330 98.4150 2157 2913 1 chr1D.!!$R1 756
13 TraesCS4D01G110300 chr2D 572830916 572833072 2156 True 3627.0 3627 97.0340 1 2156 1 chr2D.!!$R3 2155
14 TraesCS4D01G110300 chr2D 267362537 267363290 753 True 1332.0 1332 98.5430 2157 2911 1 chr2D.!!$R1 754
15 TraesCS4D01G110300 chr2D 533349310 533350066 756 True 1327.0 1327 98.2830 2157 2913 1 chr2D.!!$R2 756
16 TraesCS4D01G110300 chr7D 354335639 354336393 754 True 1336.0 1336 98.5470 2157 2913 1 chr7D.!!$R1 756
17 TraesCS4D01G110300 chr7D 417410262 417411017 755 False 1330.0 1330 98.4150 2157 2913 1 chr7D.!!$F1 756

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
770 782 1.059913 AGGCAGGTGCAGTTAAGTCT 58.940 50.0 4.01 0.0 44.36 3.24 F
1428 1443 0.244994 GATCACCAGAGCGTGTGTCT 59.755 55.0 0.00 0.0 35.18 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1807 1822 1.212751 CTCCTGCACGTCGATGTCA 59.787 57.895 7.47 8.33 0.0 3.58 R
2340 2403 1.577922 GTCCTCTCACACACGCGTA 59.422 57.895 13.44 0.00 0.0 4.42 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
29 30 1.172812 AAAGCCTGTCCTCGTTTGCC 61.173 55.000 0.00 0.00 0.00 4.52
73 74 3.621715 GGGAGAAGGCGTGTAGTAAAATG 59.378 47.826 0.00 0.00 0.00 2.32
158 159 2.452600 AAACTTGGCTGAAAGACCCA 57.547 45.000 2.10 0.00 46.74 4.51
366 373 7.571357 AGGTAGGGCCAGAAGACTATTTTAATA 59.429 37.037 6.18 0.00 40.61 0.98
455 467 4.252073 CGGTACACGCTATCCTAGACTAT 58.748 47.826 0.00 0.00 34.82 2.12
557 569 1.751924 CTACTGCACTGGAGGAGTACC 59.248 57.143 1.50 0.00 40.79 3.34
632 644 2.128507 GGGAGGGAGAGCGTGTAGG 61.129 68.421 0.00 0.00 0.00 3.18
716 728 1.295101 CGTGTATGACAGGTGGGCA 59.705 57.895 0.00 0.00 0.00 5.36
770 782 1.059913 AGGCAGGTGCAGTTAAGTCT 58.940 50.000 4.01 0.00 44.36 3.24
1157 1172 3.389925 TTGAATACACCTCGTCCGTTT 57.610 42.857 0.00 0.00 0.00 3.60
1214 1229 6.204495 TGATGTGTTGTTCGATTGATTTCTGA 59.796 34.615 0.00 0.00 0.00 3.27
1325 1340 0.865111 CTTTGACGTGCGGAACATGA 59.135 50.000 0.00 0.00 38.75 3.07
1326 1341 1.464608 CTTTGACGTGCGGAACATGAT 59.535 47.619 0.00 0.00 38.75 2.45
1428 1443 0.244994 GATCACCAGAGCGTGTGTCT 59.755 55.000 0.00 0.00 35.18 3.41
1459 1474 4.036430 AAATGCCCCGTGCCCGTA 62.036 61.111 0.00 0.00 40.16 4.02
1508 1523 0.324614 CTACCACCACATCAGCACCA 59.675 55.000 0.00 0.00 0.00 4.17
1807 1822 2.606587 AAGCAGCAAGGATCCCGGT 61.607 57.895 8.55 2.43 0.00 5.28
1811 1826 1.918293 AGCAAGGATCCCGGTGACA 60.918 57.895 8.55 0.00 0.00 3.58
1856 1871 2.032528 CAGTTCCGCCCAAGCTGA 59.967 61.111 0.00 0.00 36.60 4.26
2022 2037 0.248621 GTGGCGATGCAGCAATTACC 60.249 55.000 1.53 0.00 39.27 2.85
2776 2840 7.701539 AGTACATGCATTGGTCAATTTTCTA 57.298 32.000 0.00 0.00 0.00 2.10
2788 2852 9.781834 TTGGTCAATTTTCTATTAATACTTGCG 57.218 29.630 0.00 0.00 0.00 4.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
73 74 2.095364 TCGTACAACGAGGAGAAGCTTC 60.095 50.000 19.11 19.11 46.73 3.86
158 159 8.567948 GGTTGCAGCAAATATATTGTACACTAT 58.432 33.333 10.11 10.25 0.00 2.12
302 305 0.593128 GTTTGCACGCTCATCTGGTT 59.407 50.000 0.00 0.00 0.00 3.67
374 384 0.892755 ATGTGGCCGTCTCGAAGTTA 59.107 50.000 0.00 0.00 0.00 2.24
415 427 2.812011 ACCGTGCCTGTAAGCTTAAAAG 59.188 45.455 7.99 8.93 0.00 2.27
455 467 3.563808 GTGTGGCAGTTTCATGTGTAGAA 59.436 43.478 0.00 0.00 0.00 2.10
557 569 0.391661 ATGGCCAGAAGCGTACTGTG 60.392 55.000 13.05 0.00 45.17 3.66
632 644 3.266636 GCAAGACTAGGAGAAGCTTTCC 58.733 50.000 15.76 15.76 34.83 3.13
716 728 3.037686 TTGGCCACACACCTGTCGT 62.038 57.895 3.88 0.00 0.00 4.34
770 782 2.381752 TGATTATCCTCTCCCTCGCA 57.618 50.000 0.00 0.00 0.00 5.10
1138 1153 2.610976 CCAAACGGACGAGGTGTATTCA 60.611 50.000 0.00 0.00 0.00 2.57
1309 1324 1.018752 CCATCATGTTCCGCACGTCA 61.019 55.000 0.00 0.00 0.00 4.35
1611 1626 1.644913 CCGACCAAGAAAAACGCGT 59.355 52.632 5.58 5.58 0.00 6.01
1807 1822 1.212751 CTCCTGCACGTCGATGTCA 59.787 57.895 7.47 8.33 0.00 3.58
1811 1826 2.182791 CAGCTCCTGCACGTCGAT 59.817 61.111 0.00 0.00 42.74 3.59
1856 1871 3.420482 AAGCTTAGCCCCGGCCAT 61.420 61.111 2.24 0.00 43.17 4.40
2022 2037 6.276091 TGGAAATTACTGATCTGATGTCGAG 58.724 40.000 6.60 0.00 0.00 4.04
2340 2403 1.577922 GTCCTCTCACACACGCGTA 59.422 57.895 13.44 0.00 0.00 4.42


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.