Multiple sequence alignment - TraesCS4D01G093400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G093400 chr4D 100.000 2426 0 0 1 2426 68756050 68758475 0 4481
1 TraesCS4D01G093400 chr2D 97.736 2429 51 4 1 2426 411644111 411646538 0 4178
2 TraesCS4D01G093400 chr2D 97.736 2429 51 4 1 2426 481529559 481531986 0 4178
3 TraesCS4D01G093400 chr2D 97.674 2408 49 6 1 2403 37447137 37449542 0 4130
4 TraesCS4D01G093400 chr3D 97.774 2426 49 4 5 2426 591901005 591898581 0 4176
5 TraesCS4D01G093400 chr3D 97.449 2430 57 4 1 2426 80463163 80465591 0 4139
6 TraesCS4D01G093400 chr7D 97.611 2428 50 3 1 2426 9327357 9329778 0 4156
7 TraesCS4D01G093400 chr7D 97.570 2428 56 3 1 2426 580137464 580135038 0 4154
8 TraesCS4D01G093400 chr5D 97.243 2430 62 5 1 2426 449467509 449469937 0 4111
9 TraesCS4D01G093400 chr6D 97.164 2433 62 7 1 2426 448264598 448262166 0 4104


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G093400 chr4D 68756050 68758475 2425 False 4481 4481 100.000 1 2426 1 chr4D.!!$F1 2425
1 TraesCS4D01G093400 chr2D 411644111 411646538 2427 False 4178 4178 97.736 1 2426 1 chr2D.!!$F2 2425
2 TraesCS4D01G093400 chr2D 481529559 481531986 2427 False 4178 4178 97.736 1 2426 1 chr2D.!!$F3 2425
3 TraesCS4D01G093400 chr2D 37447137 37449542 2405 False 4130 4130 97.674 1 2403 1 chr2D.!!$F1 2402
4 TraesCS4D01G093400 chr3D 591898581 591901005 2424 True 4176 4176 97.774 5 2426 1 chr3D.!!$R1 2421
5 TraesCS4D01G093400 chr3D 80463163 80465591 2428 False 4139 4139 97.449 1 2426 1 chr3D.!!$F1 2425
6 TraesCS4D01G093400 chr7D 9327357 9329778 2421 False 4156 4156 97.611 1 2426 1 chr7D.!!$F1 2425
7 TraesCS4D01G093400 chr7D 580135038 580137464 2426 True 4154 4154 97.570 1 2426 1 chr7D.!!$R1 2425
8 TraesCS4D01G093400 chr5D 449467509 449469937 2428 False 4111 4111 97.243 1 2426 1 chr5D.!!$F1 2425
9 TraesCS4D01G093400 chr6D 448262166 448264598 2432 True 4104 4104 97.164 1 2426 1 chr6D.!!$R1 2425

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
343 345 2.099098 GGTATTTGTTCCTGGCGGATTG 59.901 50.0 0.0 0.0 39.58 2.67 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1735 1755 0.893447 GCGAGGTACTTACAGGTGGT 59.107 55.0 0.0 0.0 41.55 4.16 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
343 345 2.099098 GGTATTTGTTCCTGGCGGATTG 59.901 50.000 0.00 0.00 39.58 2.67
480 483 6.872020 ACGATCTGGTTACGGAAATATTATGG 59.128 38.462 0.00 0.00 35.18 2.74
482 485 7.386848 CGATCTGGTTACGGAAATATTATGGTT 59.613 37.037 0.00 0.00 35.18 3.67
620 624 8.873186 TGATCATACGGTCTAGTTATGGATAA 57.127 34.615 0.00 0.00 0.00 1.75
773 784 2.494059 GTGCTGTTGAAGGAGTTGCTA 58.506 47.619 0.00 0.00 0.00 3.49
786 797 8.938883 TGAAGGAGTTGCTAGATTATTTAGGAT 58.061 33.333 0.00 0.00 0.00 3.24
997 1009 2.961526 ACTATCTGGTGTTGTAGGCG 57.038 50.000 0.00 0.00 0.00 5.52
1127 1139 2.435372 AGGGCACTCAAACAAGAACA 57.565 45.000 0.00 0.00 0.00 3.18
1205 1217 1.579698 CAGATGCGTGAAGAGATGGG 58.420 55.000 0.00 0.00 0.00 4.00
1423 1440 2.766828 GACTACAAGGCTATGGTGGAGT 59.233 50.000 1.39 1.39 39.20 3.85
1457 1474 1.988107 AGGAAAGATGCTGGAAGACCA 59.012 47.619 0.00 0.00 44.76 4.02
2013 2033 2.950309 ACTCGTATGTAGGTGCTGGTAG 59.050 50.000 0.00 0.00 0.00 3.18
2049 2070 3.450817 TCATAGGGATTGTGAGCTTTCGA 59.549 43.478 0.00 0.00 0.00 3.71
2133 2154 7.987458 ACGTATTGGACTATGATTTTCTCATGT 59.013 33.333 0.00 0.00 44.48 3.21
2354 2375 2.118679 TGGTCGGACATGGATTCAGAT 58.881 47.619 10.76 0.00 0.00 2.90
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
23 24 4.893524 ACATAACTCCCGTGATATCTGACA 59.106 41.667 3.98 0.00 0.00 3.58
41 42 4.942761 GGTACGATGGAAGGGTACATAA 57.057 45.455 0.00 0.00 38.56 1.90
350 352 3.998341 GCACCAAAATAGTACCTTCGACA 59.002 43.478 0.00 0.00 0.00 4.35
480 483 4.096532 GGGCTAGAAAATTAGCTCCACAAC 59.903 45.833 0.00 0.00 44.32 3.32
482 485 3.523564 AGGGCTAGAAAATTAGCTCCACA 59.476 43.478 0.00 0.00 46.25 4.17
786 797 6.152661 GGTATGAACAACCTCATCCAAATCAA 59.847 38.462 0.00 0.00 37.27 2.57
997 1009 0.818938 TGCACATGTGAATCCATGGC 59.181 50.000 29.80 10.92 45.21 4.40
1019 1031 1.796253 CGTACTCCGCACGCTTATTGA 60.796 52.381 0.00 0.00 31.94 2.57
1069 1081 2.049802 TTGGACCTTCGCGTCGAC 60.050 61.111 5.77 5.18 34.89 4.20
1127 1139 2.493675 AGCATCCTATCGACATACGCAT 59.506 45.455 0.00 0.00 42.26 4.73
1423 1440 5.688500 GCATCTTTCCTTCCATCATGACCTA 60.689 44.000 0.00 0.00 0.00 3.08
1457 1474 1.401552 CGTGGGATTGAAACATCGCAT 59.598 47.619 4.03 0.00 40.86 4.73
1603 1623 8.455903 ACTGCATATGAATAGCTTACACAAAT 57.544 30.769 6.97 0.00 0.00 2.32
1735 1755 0.893447 GCGAGGTACTTACAGGTGGT 59.107 55.000 0.00 0.00 41.55 4.16
2013 2033 8.695456 ACAATCCCTATGAATGTAAAATTCCAC 58.305 33.333 0.00 0.00 35.31 4.02
2133 2154 6.763715 ATAACCATATCCAGCCACTTCTTA 57.236 37.500 0.00 0.00 0.00 2.10
2354 2375 9.685276 ATTGATGTAACATGAAGAATAGGAACA 57.315 29.630 0.00 0.00 0.00 3.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.