Multiple sequence alignment - TraesCS4D01G091100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G091100 chr4D 100.000 2261 0 0 1 2261 65939148 65941408 0.000000e+00 4176
1 TraesCS4D01G091100 chr4A 96.801 1938 42 9 1 1921 529627048 529625114 0.000000e+00 3217
2 TraesCS4D01G091100 chr4A 95.732 164 6 1 1920 2083 529624990 529624828 1.720000e-66 263
3 TraesCS4D01G091100 chr4A 97.297 148 3 1 2115 2261 529624830 529624683 1.340000e-62 250
4 TraesCS4D01G091100 chr4B 96.313 1763 36 14 522 2261 96641896 96643652 0.000000e+00 2868
5 TraesCS4D01G091100 chr4B 97.002 467 14 0 1 467 96641298 96641764 0.000000e+00 785


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G091100 chr4D 65939148 65941408 2260 False 4176.000000 4176 100.0000 1 2261 1 chr4D.!!$F1 2260
1 TraesCS4D01G091100 chr4A 529624683 529627048 2365 True 1243.333333 3217 96.6100 1 2261 3 chr4A.!!$R1 2260
2 TraesCS4D01G091100 chr4B 96641298 96643652 2354 False 1826.500000 2868 96.6575 1 2261 2 chr4B.!!$F1 2260

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
912 1022 0.107831 CAAACCCGTCCAACTCCTCA 59.892 55.0 0.0 0.0 0.0 3.86 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2021 2259 1.526917 GGCCATCTAGCATTGCGGT 60.527 57.895 0.0 0.0 0.0 5.68 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
211 212 2.125753 GCTCGCTGTCCAGACCAG 60.126 66.667 0.00 0.00 0.00 4.00
265 266 0.906066 TGTTATGGGGTAAGCGCTCA 59.094 50.000 12.06 3.76 0.00 4.26
343 344 1.685820 GGGAGGGAGTTGGGAGTTG 59.314 63.158 0.00 0.00 0.00 3.16
524 607 5.048083 TCGATGGGATTTCCTTCAAAAACTG 60.048 40.000 0.00 0.00 39.06 3.16
912 1022 0.107831 CAAACCCGTCCAACTCCTCA 59.892 55.000 0.00 0.00 0.00 3.86
954 1064 0.586319 CTTCTTGCTCGGTTTTCGCA 59.414 50.000 0.00 0.00 39.05 5.10
1065 1175 1.065491 TCGGGCATGTATTCAACAGCT 60.065 47.619 0.00 0.00 42.70 4.24
1635 1747 1.741770 CTTGTAGGGCTGACACCGC 60.742 63.158 0.00 0.00 0.00 5.68
1644 1756 0.100503 GCTGACACCGCAAAACAACT 59.899 50.000 0.00 0.00 0.00 3.16
1870 1982 8.356533 AGCATTTTCCAAATAAATTAGATGCG 57.643 30.769 0.00 0.00 0.00 4.73
2021 2259 8.645110 ACTAGTAGTTAAGTTACTTGAAAGCCA 58.355 33.333 8.00 0.00 33.60 4.75
2048 2286 1.051812 GCTAGATGGCCTGGCTCTTA 58.948 55.000 19.68 3.31 44.86 2.10
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
211 212 4.135493 GTCGCGAACTCGGCAAGC 62.135 66.667 12.06 0.00 40.23 4.01
524 607 4.959631 TGTTGTGAATCTTTCGTACGAC 57.040 40.909 19.36 5.88 0.00 4.34
651 741 2.224523 TGTATGATCCTGCCGATTTCCC 60.225 50.000 0.00 0.00 0.00 3.97
693 783 2.238521 TGATTTCTTTTTCAGCCGGCT 58.761 42.857 27.08 27.08 0.00 5.52
912 1022 2.456577 GAAGAGGAGAGGAAGCAGAGT 58.543 52.381 0.00 0.00 0.00 3.24
954 1064 0.394352 CCAAACCTAAGATGCCGCCT 60.394 55.000 0.00 0.00 0.00 5.52
1028 1138 0.179150 CGAAGAGGAGGTGAAGAGCG 60.179 60.000 0.00 0.00 0.00 5.03
1065 1175 2.693762 GGACGACATCACGGACGGA 61.694 63.158 0.00 0.00 37.61 4.69
1635 1747 1.069049 CTTGGGGAGCCAGTTGTTTTG 59.931 52.381 0.00 0.00 0.00 2.44
1870 1982 7.282675 CCATCTCAGATTGGCTAATCCATATTC 59.717 40.741 18.20 0.00 46.04 1.75
1959 2196 1.529438 CCAGACGAGTTGCGCTAAAAA 59.471 47.619 9.73 0.00 46.04 1.94
2021 2259 1.526917 GGCCATCTAGCATTGCGGT 60.527 57.895 0.00 0.00 0.00 5.68
2085 2323 4.341235 TGGTAGTGGAGACTATGAAATCCG 59.659 45.833 0.00 0.00 37.03 4.18
2158 2398 2.093128 CCACCACCTCCCAATGTAGTAC 60.093 54.545 0.00 0.00 0.00 2.73


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.