Multiple sequence alignment - TraesCS4D01G076300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G076300 chr4D 100.000 2324 0 0 1 2324 50793620 50791297 0 4292
1 TraesCS4D01G076300 chr5D 95.169 1387 38 8 964 2324 45513776 45515159 0 2163
2 TraesCS4D01G076300 chr5D 95.374 1362 44 9 964 2324 44525806 44524463 0 2148
3 TraesCS4D01G076300 chr5D 94.088 1370 54 9 964 2324 517041407 517040056 0 2056
4 TraesCS4D01G076300 chr5D 95.262 992 24 3 1 970 520482563 520483553 0 1550
5 TraesCS4D01G076300 chr5D 95.156 991 25 3 2 970 336341978 336342967 0 1543
6 TraesCS4D01G076300 chr5D 94.859 992 28 3 1 970 559987905 559988895 0 1528
7 TraesCS4D01G076300 chr5D 95.863 846 27 2 964 1801 473091931 473091086 0 1362
8 TraesCS4D01G076300 chr3D 94.744 1389 45 6 964 2324 447968481 447969869 0 2135
9 TraesCS4D01G076300 chr3D 92.796 1402 44 18 964 2324 25092668 25094053 0 1977
10 TraesCS4D01G076300 chr3D 92.847 1370 46 15 968 2324 527514755 527513425 0 1940
11 TraesCS4D01G076300 chr3A 94.384 1371 61 7 964 2324 235201604 235200240 0 2091
12 TraesCS4D01G076300 chr3A 94.859 992 28 2 1 970 719861574 719860584 0 1528
13 TraesCS4D01G076300 chr7A 93.659 1372 63 5 964 2324 30971483 30970125 0 2030
14 TraesCS4D01G076300 chr5A 93.787 1368 54 14 964 2324 548404800 548403457 0 2026
15 TraesCS4D01G076300 chr2D 95.363 992 23 3 1 970 435218968 435217978 0 1555
16 TraesCS4D01G076300 chr2D 93.246 992 43 4 1 970 590923414 590924403 0 1439
17 TraesCS4D01G076300 chr2D 92.901 986 48 2 1 964 551262220 551261235 0 1413
18 TraesCS4D01G076300 chr2D 95.863 846 27 4 964 1801 218369629 218368784 0 1362
19 TraesCS4D01G076300 chr6D 95.262 992 24 3 1 970 109969630 109968640 0 1550
20 TraesCS4D01G076300 chr6D 95.161 992 25 3 1 970 277561073 277562063 0 1544
21 TraesCS4D01G076300 chr4A 95.065 993 25 3 1 970 661618588 661619579 0 1541
22 TraesCS4D01G076300 chr6B 94.960 992 27 2 1 970 495756934 495755944 0 1533
23 TraesCS4D01G076300 chr1B 94.758 992 29 2 1 970 42155957 42156947 0 1522
24 TraesCS4D01G076300 chr1B 93.721 876 44 4 964 1832 261680474 261681345 0 1303
25 TraesCS4D01G076300 chr4B 94.657 992 30 2 1 970 660374463 660375453 0 1517
26 TraesCS4D01G076300 chr4B 94.556 992 31 2 1 970 552603438 552604428 0 1511
27 TraesCS4D01G076300 chr4B 94.749 876 35 4 964 1832 648677785 648676914 0 1352
28 TraesCS4D01G076300 chr3B 94.636 988 31 2 1 966 722340719 722339732 0 1511
29 TraesCS4D01G076300 chr5B 94.034 989 36 2 1 966 129120658 129119670 0 1478
30 TraesCS4D01G076300 chr5B 94.028 988 36 2 1 966 50594094 50593108 0 1476
31 TraesCS4D01G076300 chr7D 95.179 892 29 7 1443 2324 439703163 439704050 0 1397
32 TraesCS4D01G076300 chr1A 95.434 876 33 1 964 1832 543264438 543263563 0 1389
33 TraesCS4D01G076300 chr1D 95.626 846 29 2 964 1801 435232301 435233146 0 1351
34 TraesCS4D01G076300 chr1D 95.674 809 25 7 1518 2324 446630015 446629215 0 1291
35 TraesCS4D01G076300 chrUn 92.559 551 19 1 1 529 87148385 87147835 0 771


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G076300 chr4D 50791297 50793620 2323 True 4292 4292 100.000 1 2324 1 chr4D.!!$R1 2323
1 TraesCS4D01G076300 chr5D 45513776 45515159 1383 False 2163 2163 95.169 964 2324 1 chr5D.!!$F1 1360
2 TraesCS4D01G076300 chr5D 44524463 44525806 1343 True 2148 2148 95.374 964 2324 1 chr5D.!!$R1 1360
3 TraesCS4D01G076300 chr5D 517040056 517041407 1351 True 2056 2056 94.088 964 2324 1 chr5D.!!$R3 1360
4 TraesCS4D01G076300 chr5D 520482563 520483553 990 False 1550 1550 95.262 1 970 1 chr5D.!!$F3 969
5 TraesCS4D01G076300 chr5D 336341978 336342967 989 False 1543 1543 95.156 2 970 1 chr5D.!!$F2 968
6 TraesCS4D01G076300 chr5D 559987905 559988895 990 False 1528 1528 94.859 1 970 1 chr5D.!!$F4 969
7 TraesCS4D01G076300 chr5D 473091086 473091931 845 True 1362 1362 95.863 964 1801 1 chr5D.!!$R2 837
8 TraesCS4D01G076300 chr3D 447968481 447969869 1388 False 2135 2135 94.744 964 2324 1 chr3D.!!$F2 1360
9 TraesCS4D01G076300 chr3D 25092668 25094053 1385 False 1977 1977 92.796 964 2324 1 chr3D.!!$F1 1360
10 TraesCS4D01G076300 chr3D 527513425 527514755 1330 True 1940 1940 92.847 968 2324 1 chr3D.!!$R1 1356
11 TraesCS4D01G076300 chr3A 235200240 235201604 1364 True 2091 2091 94.384 964 2324 1 chr3A.!!$R1 1360
12 TraesCS4D01G076300 chr3A 719860584 719861574 990 True 1528 1528 94.859 1 970 1 chr3A.!!$R2 969
13 TraesCS4D01G076300 chr7A 30970125 30971483 1358 True 2030 2030 93.659 964 2324 1 chr7A.!!$R1 1360
14 TraesCS4D01G076300 chr5A 548403457 548404800 1343 True 2026 2026 93.787 964 2324 1 chr5A.!!$R1 1360
15 TraesCS4D01G076300 chr2D 435217978 435218968 990 True 1555 1555 95.363 1 970 1 chr2D.!!$R2 969
16 TraesCS4D01G076300 chr2D 590923414 590924403 989 False 1439 1439 93.246 1 970 1 chr2D.!!$F1 969
17 TraesCS4D01G076300 chr2D 551261235 551262220 985 True 1413 1413 92.901 1 964 1 chr2D.!!$R3 963
18 TraesCS4D01G076300 chr2D 218368784 218369629 845 True 1362 1362 95.863 964 1801 1 chr2D.!!$R1 837
19 TraesCS4D01G076300 chr6D 109968640 109969630 990 True 1550 1550 95.262 1 970 1 chr6D.!!$R1 969
20 TraesCS4D01G076300 chr6D 277561073 277562063 990 False 1544 1544 95.161 1 970 1 chr6D.!!$F1 969
21 TraesCS4D01G076300 chr4A 661618588 661619579 991 False 1541 1541 95.065 1 970 1 chr4A.!!$F1 969
22 TraesCS4D01G076300 chr6B 495755944 495756934 990 True 1533 1533 94.960 1 970 1 chr6B.!!$R1 969
23 TraesCS4D01G076300 chr1B 42155957 42156947 990 False 1522 1522 94.758 1 970 1 chr1B.!!$F1 969
24 TraesCS4D01G076300 chr1B 261680474 261681345 871 False 1303 1303 93.721 964 1832 1 chr1B.!!$F2 868
25 TraesCS4D01G076300 chr4B 660374463 660375453 990 False 1517 1517 94.657 1 970 1 chr4B.!!$F2 969
26 TraesCS4D01G076300 chr4B 552603438 552604428 990 False 1511 1511 94.556 1 970 1 chr4B.!!$F1 969
27 TraesCS4D01G076300 chr4B 648676914 648677785 871 True 1352 1352 94.749 964 1832 1 chr4B.!!$R1 868
28 TraesCS4D01G076300 chr3B 722339732 722340719 987 True 1511 1511 94.636 1 966 1 chr3B.!!$R1 965
29 TraesCS4D01G076300 chr5B 129119670 129120658 988 True 1478 1478 94.034 1 966 1 chr5B.!!$R2 965
30 TraesCS4D01G076300 chr5B 50593108 50594094 986 True 1476 1476 94.028 1 966 1 chr5B.!!$R1 965
31 TraesCS4D01G076300 chr7D 439703163 439704050 887 False 1397 1397 95.179 1443 2324 1 chr7D.!!$F1 881
32 TraesCS4D01G076300 chr1A 543263563 543264438 875 True 1389 1389 95.434 964 1832 1 chr1A.!!$R1 868
33 TraesCS4D01G076300 chr1D 435232301 435233146 845 False 1351 1351 95.626 964 1801 1 chr1D.!!$F1 837
34 TraesCS4D01G076300 chr1D 446629215 446630015 800 True 1291 1291 95.674 1518 2324 1 chr1D.!!$R1 806
35 TraesCS4D01G076300 chrUn 87147835 87148385 550 True 771 771 92.559 1 529 1 chrUn.!!$R1 528

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
692 718 0.099436 GGAATGCATGCGTCACCTTC 59.901 55.0 13.95 6.43 0.0 3.46 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1632 1702 2.295349 ACCTTGTGCTCATTGCTTCTTG 59.705 45.455 0.0 0.0 43.37 3.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
226 249 7.526041 TGGATTCTATTTATGGTAACTGGCAT 58.474 34.615 0.00 0.00 37.61 4.40
272 295 1.699634 TCAAAGGTGAAGTGGAGAGGG 59.300 52.381 0.00 0.00 0.00 4.30
656 682 0.889186 GGCCGTGGACAATGTGTTCT 60.889 55.000 0.00 0.00 0.00 3.01
692 718 0.099436 GGAATGCATGCGTCACCTTC 59.901 55.000 13.95 6.43 0.00 3.46
991 1017 3.635591 CCTGCTATGGAGGGAAAACAAT 58.364 45.455 0.00 0.00 0.00 2.71
1073 1099 3.367190 GGTAGACCAAGGAAGAGTCGAAC 60.367 52.174 0.00 0.00 35.65 3.95
1258 1286 5.831702 AGCCTCAACAGATGATGAAAATC 57.168 39.130 0.00 0.00 37.44 2.17
1283 1311 1.228245 AACAGCCGGTTGCATCAGT 60.228 52.632 19.28 0.00 44.83 3.41
1355 1384 9.123902 TGATTTTGACGATGATCCAAAATATCT 57.876 29.630 16.81 2.98 45.17 1.98
1384 1413 3.947612 ATGATTCAAGTGAGGCTCCAT 57.052 42.857 12.86 2.41 0.00 3.41
1484 1553 4.895889 TCCAAATGGTGACCAATTGTTGTA 59.104 37.500 25.83 9.83 41.38 2.41
1611 1681 1.067142 TGAAGAAGACGCGCAAGGTAT 60.067 47.619 5.73 0.00 38.28 2.73
1632 1702 2.296471 TCGACAACCAAGAGGAGAAGAC 59.704 50.000 0.00 0.00 38.69 3.01
1700 1771 3.845781 AGCTCAAGGAACAGACAGAAA 57.154 42.857 0.00 0.00 0.00 2.52
1783 1875 7.054124 GGATGATGTTGGACCTATGTTAGAAA 58.946 38.462 0.00 0.00 0.00 2.52
2023 2124 1.394917 CAGACTATGTGCGCTGGTTTC 59.605 52.381 9.73 0.00 0.00 2.78
2169 2278 2.997986 CAATCCAAAATGAAGCTGTGGC 59.002 45.455 0.00 0.00 39.06 5.01
2177 2287 1.165907 TGAAGCTGTGGCGAGGTTTG 61.166 55.000 0.00 0.00 44.37 2.93
2250 2363 2.027192 ACGGCCTCATTTCTAAGCAAGA 60.027 45.455 0.00 0.00 0.00 3.02
2294 2409 7.961326 AATCAGCCAAATAACTTTCCTACAT 57.039 32.000 0.00 0.00 0.00 2.29
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
272 295 0.546598 ACAATACTACCTGGGCTGGC 59.453 55.000 0.00 0.00 0.00 4.85
319 342 3.907474 TCTTTGTCACTCCCCTGAATGTA 59.093 43.478 0.00 0.00 0.00 2.29
428 453 4.530875 CTCCCTATGAGAAAAGTGGCATT 58.469 43.478 0.00 0.00 44.42 3.56
542 567 2.101415 GCAAAAACCAAGTCCAGCTCTT 59.899 45.455 0.00 0.00 0.00 2.85
656 682 3.973472 TTCCCTATGCTCTACTCCAGA 57.027 47.619 0.00 0.00 0.00 3.86
991 1017 0.923358 GGGTCCACCATGTCCCATTA 59.077 55.000 0.00 0.00 39.68 1.90
1073 1099 2.507992 CTTCGCTGCGAGGTCTGG 60.508 66.667 24.61 8.48 37.14 3.86
1258 1286 4.079446 AACCGGCTGTTGACCATG 57.921 55.556 0.00 0.00 35.31 3.66
1283 1311 3.181449 TGGAACCTCGTCAAAATCCTCAA 60.181 43.478 0.00 0.00 0.00 3.02
1355 1384 6.664816 AGCCTCACTTGAATCATTATTTGGAA 59.335 34.615 0.00 0.00 0.00 3.53
1384 1413 2.435805 GAGCCTCACTTGGATCACCATA 59.564 50.000 0.00 0.00 46.34 2.74
1459 1521 2.899256 ACAATTGGTCACCATTTGGAGG 59.101 45.455 27.46 9.75 44.37 4.30
1484 1553 7.281100 GCAAGATTTACATACCTAGCAGAACTT 59.719 37.037 0.00 0.00 0.00 2.66
1611 1681 2.296471 GTCTTCTCCTCTTGGTTGTCGA 59.704 50.000 0.00 0.00 34.23 4.20
1632 1702 2.295349 ACCTTGTGCTCATTGCTTCTTG 59.705 45.455 0.00 0.00 43.37 3.02
1700 1771 7.833285 AATTATTCATAAATAGCGTTGGGGT 57.167 32.000 0.00 0.00 0.00 4.95
1783 1875 8.853126 CATAGGTCCAACATCATTCAAACATAT 58.147 33.333 0.00 0.00 0.00 1.78
2058 2162 8.934023 AGTTAGGTTTGACCAGAATTCAAATA 57.066 30.769 8.44 0.00 43.16 1.40
2169 2278 7.462109 TTTCATGAAAATTTCACAAACCTCG 57.538 32.000 18.45 0.00 43.48 4.63


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.