Multiple sequence alignment - TraesCS4D01G049000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G049000 chr4D 100.000 4240 0 0 1 4240 25346140 25350379 0 7830
1 TraesCS4D01G049000 chr5D 97.951 4245 65 10 1 4240 424617894 424613667 0 7337
2 TraesCS4D01G049000 chr5D 97.669 4247 63 13 1 4240 423195959 423200176 0 7262
3 TraesCS4D01G049000 chr5D 98.046 1177 20 3 3064 4240 217021187 217022360 0 2043
4 TraesCS4D01G049000 chr3D 97.974 4245 59 14 1 4240 132534836 132539058 0 7337
5 TraesCS4D01G049000 chr3D 97.440 4141 92 11 1 4130 382772297 382768160 0 7047
6 TraesCS4D01G049000 chr3D 97.504 3485 74 9 1 3477 134856359 134852880 0 5941
7 TraesCS4D01G049000 chr2B 96.326 4219 138 14 1 4208 95514106 95518318 0 6916
8 TraesCS4D01G049000 chr5A 95.952 4249 141 14 1 4240 534001765 534005991 0 6865
9 TraesCS4D01G049000 chr5B 96.146 3736 128 11 515 4240 398082123 398085852 0 6087
10 TraesCS4D01G049000 chr7B 96.220 3492 119 9 4 3487 223192133 223188647 0 5705
11 TraesCS4D01G049000 chr2D 90.451 1152 85 12 2556 3685 363350465 363349317 0 1495
12 TraesCS4D01G049000 chr6B 93.671 632 34 6 3611 4240 653254325 653254952 0 941


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G049000 chr4D 25346140 25350379 4239 False 7830 7830 100.000 1 4240 1 chr4D.!!$F1 4239
1 TraesCS4D01G049000 chr5D 424613667 424617894 4227 True 7337 7337 97.951 1 4240 1 chr5D.!!$R1 4239
2 TraesCS4D01G049000 chr5D 423195959 423200176 4217 False 7262 7262 97.669 1 4240 1 chr5D.!!$F2 4239
3 TraesCS4D01G049000 chr5D 217021187 217022360 1173 False 2043 2043 98.046 3064 4240 1 chr5D.!!$F1 1176
4 TraesCS4D01G049000 chr3D 132534836 132539058 4222 False 7337 7337 97.974 1 4240 1 chr3D.!!$F1 4239
5 TraesCS4D01G049000 chr3D 382768160 382772297 4137 True 7047 7047 97.440 1 4130 1 chr3D.!!$R2 4129
6 TraesCS4D01G049000 chr3D 134852880 134856359 3479 True 5941 5941 97.504 1 3477 1 chr3D.!!$R1 3476
7 TraesCS4D01G049000 chr2B 95514106 95518318 4212 False 6916 6916 96.326 1 4208 1 chr2B.!!$F1 4207
8 TraesCS4D01G049000 chr5A 534001765 534005991 4226 False 6865 6865 95.952 1 4240 1 chr5A.!!$F1 4239
9 TraesCS4D01G049000 chr5B 398082123 398085852 3729 False 6087 6087 96.146 515 4240 1 chr5B.!!$F1 3725
10 TraesCS4D01G049000 chr7B 223188647 223192133 3486 True 5705 5705 96.220 4 3487 1 chr7B.!!$R1 3483
11 TraesCS4D01G049000 chr2D 363349317 363350465 1148 True 1495 1495 90.451 2556 3685 1 chr2D.!!$R1 1129
12 TraesCS4D01G049000 chr6B 653254325 653254952 627 False 941 941 93.671 3611 4240 1 chr6B.!!$F1 629

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
201 206 5.371115 TGATGCAGTATGAATATCGACGA 57.629 39.130 0.0 0.0 31.27 4.20 F
1075 1086 1.373435 GGTCGTGGTGTTGGGATGA 59.627 57.895 0.0 0.0 0.00 2.92 F
1778 1798 0.109132 CAGATGAAAAAGCCGCCACC 60.109 55.000 0.0 0.0 0.00 4.61 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1772 1792 1.153628 CGTCCCTAAAGAGGTGGCG 60.154 63.158 0.0 0.0 41.95 5.69 R
2409 2432 2.206750 GCTTCATAATCGTTACCGGCA 58.793 47.619 0.0 0.0 33.95 5.69 R
3602 3659 5.104374 GCGCTACCATAGTTTAGTGTACAA 58.896 41.667 0.0 0.0 0.00 2.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
201 206 5.371115 TGATGCAGTATGAATATCGACGA 57.629 39.130 0.00 0.0 31.27 4.20
1075 1086 1.373435 GGTCGTGGTGTTGGGATGA 59.627 57.895 0.00 0.0 0.00 2.92
1194 1212 7.067421 ACAACATTATAGAGGAGTACAGGCTA 58.933 38.462 0.00 0.0 0.00 3.93
1399 1418 2.560504 CACAGGTAACACTTGAGCACA 58.439 47.619 0.00 0.0 41.41 4.57
1741 1761 5.485353 TCAAGGGTGATATGGATGATCCTAC 59.515 44.000 13.44 4.3 37.46 3.18
1772 1792 5.649831 ACCAGAAGTATCAGATGAAAAAGCC 59.350 40.000 0.00 0.0 0.00 4.35
1778 1798 0.109132 CAGATGAAAAAGCCGCCACC 60.109 55.000 0.00 0.0 0.00 4.61
2409 2432 3.838903 ACATTAGACCCGGAAAGAAGACT 59.161 43.478 0.73 0.0 0.00 3.24
2523 2548 7.728148 TGATTGGTTACACGGTACATACATAT 58.272 34.615 0.00 0.0 0.00 1.78
2855 2881 4.142271 GCAACCGGAATTGTGAATTATCCA 60.142 41.667 9.46 0.0 31.83 3.41
3289 3319 1.272872 TGGGTGGTACTGGAGGACTAC 60.273 57.143 0.00 0.0 0.00 2.73
3657 3717 1.149987 ACGCGGCGATTTTGTTTAGA 58.850 45.000 30.94 0.0 0.00 2.10
3804 3866 6.326375 CAAAAAGTTGGTTTACAGCACACTA 58.674 36.000 0.00 0.0 31.96 2.74
3968 4031 3.136123 CCCAACAGGGCAGCATCG 61.136 66.667 0.00 0.0 35.34 3.84
3969 4032 2.046023 CCAACAGGGCAGCATCGA 60.046 61.111 0.00 0.0 0.00 3.59
3970 4033 2.401766 CCAACAGGGCAGCATCGAC 61.402 63.158 0.00 0.0 0.00 4.20
3971 4034 2.434884 AACAGGGCAGCATCGACG 60.435 61.111 0.00 0.0 0.00 5.12
3972 4035 3.958147 AACAGGGCAGCATCGACGG 62.958 63.158 0.00 0.0 0.00 4.79
3976 4039 3.845259 GGCAGCATCGACGGGGTA 61.845 66.667 0.00 0.0 0.00 3.69
4117 4193 3.268965 GAGACAGCCAGACGCGACA 62.269 63.158 15.93 0.0 44.76 4.35
4196 4272 3.335729 CCGGCCCAGTTAACCCCT 61.336 66.667 0.88 0.0 0.00 4.79
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
201 206 6.653526 TTTGAACAGAACATGGAATCACAT 57.346 33.333 0.00 0.0 0.00 3.21
1399 1418 8.464404 CAATTCAGTGATGGACATTAAAGTGAT 58.536 33.333 0.00 0.0 0.00 3.06
1741 1761 5.363868 TCATCTGATACTTCTGGTACTTGGG 59.636 44.000 0.00 0.0 32.72 4.12
1772 1792 1.153628 CGTCCCTAAAGAGGTGGCG 60.154 63.158 0.00 0.0 41.95 5.69
1778 1798 1.747709 TCTCGTCCGTCCCTAAAGAG 58.252 55.000 0.00 0.0 0.00 2.85
2036 2056 5.677319 TGTTAACACCACCATTTTGGAAA 57.323 34.783 3.59 0.0 40.96 3.13
2409 2432 2.206750 GCTTCATAATCGTTACCGGCA 58.793 47.619 0.00 0.0 33.95 5.69
2523 2548 7.686438 AAAACACAATCAGCACATACTATCA 57.314 32.000 0.00 0.0 0.00 2.15
2855 2881 5.271598 TGAATAGGCCAATTGGAAACATCT 58.728 37.500 29.02 15.2 42.32 2.90
3474 3526 9.533253 AAACGGTAAGTACGCATATAACTATTT 57.467 29.630 0.00 0.0 34.00 1.40
3602 3659 5.104374 GCGCTACCATAGTTTAGTGTACAA 58.896 41.667 0.00 0.0 0.00 2.41
3804 3866 8.975663 AGCTTTTCTAAACTAAACTAACACCT 57.024 30.769 0.00 0.0 0.00 4.00
3968 4031 2.410469 CCGTCGATGTACCCCGTC 59.590 66.667 3.52 0.0 0.00 4.79
3969 4032 3.142838 CCCGTCGATGTACCCCGT 61.143 66.667 3.52 0.0 0.00 5.28
3970 4033 3.908081 CCCCGTCGATGTACCCCG 61.908 72.222 3.52 0.0 0.00 5.73
3971 4034 1.455587 TACCCCGTCGATGTACCCC 60.456 63.158 3.52 0.0 0.00 4.95
3972 4035 0.753111 ACTACCCCGTCGATGTACCC 60.753 60.000 3.52 0.0 0.00 3.69
3973 4036 1.967319 TACTACCCCGTCGATGTACC 58.033 55.000 3.52 0.0 0.00 3.34
3974 4037 2.033424 GGTTACTACCCCGTCGATGTAC 59.967 54.545 3.52 0.0 38.60 2.90
3975 4038 2.297701 GGTTACTACCCCGTCGATGTA 58.702 52.381 3.52 0.0 38.60 2.29
3976 4039 1.106285 GGTTACTACCCCGTCGATGT 58.894 55.000 3.52 0.0 38.60 3.06


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.