Multiple sequence alignment - TraesCS4D01G044200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G044200 chr4D 100.000 2141 0 0 1 2141 19928815 19930955 0 3954
1 TraesCS4D01G044200 chr5D 97.807 2143 45 2 1 2141 503218458 503220600 0 3696
2 TraesCS4D01G044200 chr5D 97.294 2143 56 2 1 2141 503277986 503275844 0 3635
3 TraesCS4D01G044200 chr3B 97.667 2143 48 2 1 2141 201527264 201529406 0 3679
4 TraesCS4D01G044200 chr1A 97.667 2143 48 2 1 2141 554512488 554514630 0 3679
5 TraesCS4D01G044200 chr3D 97.527 2143 48 4 1 2141 589279302 589277163 0 3659
6 TraesCS4D01G044200 chr6D 97.340 2143 55 2 1 2141 168255166 168257308 0 3640
7 TraesCS4D01G044200 chr3A 97.294 2143 54 4 1 2141 672909767 672907627 0 3633
8 TraesCS4D01G044200 chr1D 97.247 2143 54 5 1 2141 254397869 254395730 0 3626
9 TraesCS4D01G044200 chrUn 97.200 2143 57 3 1 2141 216518362 216516221 0 3622


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G044200 chr4D 19928815 19930955 2140 False 3954 3954 100.000 1 2141 1 chr4D.!!$F1 2140
1 TraesCS4D01G044200 chr5D 503218458 503220600 2142 False 3696 3696 97.807 1 2141 1 chr5D.!!$F1 2140
2 TraesCS4D01G044200 chr5D 503275844 503277986 2142 True 3635 3635 97.294 1 2141 1 chr5D.!!$R1 2140
3 TraesCS4D01G044200 chr3B 201527264 201529406 2142 False 3679 3679 97.667 1 2141 1 chr3B.!!$F1 2140
4 TraesCS4D01G044200 chr1A 554512488 554514630 2142 False 3679 3679 97.667 1 2141 1 chr1A.!!$F1 2140
5 TraesCS4D01G044200 chr3D 589277163 589279302 2139 True 3659 3659 97.527 1 2141 1 chr3D.!!$R1 2140
6 TraesCS4D01G044200 chr6D 168255166 168257308 2142 False 3640 3640 97.340 1 2141 1 chr6D.!!$F1 2140
7 TraesCS4D01G044200 chr3A 672907627 672909767 2140 True 3633 3633 97.294 1 2141 1 chr3A.!!$R1 2140
8 TraesCS4D01G044200 chr1D 254395730 254397869 2139 True 3626 3626 97.247 1 2141 1 chr1D.!!$R1 2140
9 TraesCS4D01G044200 chrUn 216516221 216518362 2141 True 3622 3622 97.200 1 2141 1 chrUn.!!$R1 2140

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
923 926 2.674357 GAGTTCGGCGCTTTAACCATTA 59.326 45.455 7.64 0.0 0.0 1.9 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1968 1973 4.087892 ATCTTGCGCGGCAGGTCT 62.088 61.111 8.83 0.0 40.61 3.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
309 311 5.221224 GCCGTCCATGGATCAAATTATTTCA 60.221 40.000 19.62 0.00 0.00 2.69
405 407 9.616156 TTTTGCCGTATTATTAAGTATTCTCCA 57.384 29.630 0.00 0.00 0.00 3.86
447 450 3.326880 AGAAGTGGAACAGAATAACCCGT 59.673 43.478 0.00 0.00 41.80 5.28
470 473 6.036735 CGTTTGAAGGGTAATGATCATACGTT 59.963 38.462 9.04 10.09 40.17 3.99
571 574 5.008712 CACCTTAACACCAAAGAAGAGTTCC 59.991 44.000 0.00 0.00 0.00 3.62
744 747 8.973378 CCAGTATCGATAAGAATTTGAGTTCTC 58.027 37.037 6.72 0.00 37.46 2.87
770 773 9.650371 CATTGTTCTTATGTTATGGTACGAATG 57.350 33.333 0.00 0.00 0.00 2.67
907 910 6.475402 CCCGCAAATTTACCAATTATGAGTTC 59.525 38.462 0.00 0.00 31.89 3.01
923 926 2.674357 GAGTTCGGCGCTTTAACCATTA 59.326 45.455 7.64 0.00 0.00 1.90
957 960 5.303333 TGCTTAACAGGGATCATCGTACATA 59.697 40.000 0.00 0.00 0.00 2.29
1072 1075 1.407258 CACCTCTCTGGATCCTCGAAC 59.593 57.143 14.23 0.00 39.71 3.95
1082 1085 4.026744 TGGATCCTCGAACTGAAAGAGAT 58.973 43.478 14.23 0.00 37.43 2.75
1092 1095 6.378564 TCGAACTGAAAGAGATATTGAGAGGT 59.621 38.462 0.00 0.00 37.43 3.85
1321 1324 8.367911 ACGTATATTCCTTGCTCATTATCAGAA 58.632 33.333 0.00 0.00 0.00 3.02
1401 1404 6.428083 GAAAACCCTTTTCATTCCCCTTAA 57.572 37.500 3.13 0.00 46.34 1.85
1821 1826 9.085250 GGCTCTTGTACAAAATAGACTTACTAC 57.915 37.037 10.03 0.00 33.62 2.73
1968 1973 8.506168 TCTTTCTCTTTTGAGTTTTTCTAGCA 57.494 30.769 0.00 0.00 46.30 3.49
2043 2049 3.777465 TCGCTTCTTATGTACTCGCTT 57.223 42.857 0.00 0.00 0.00 4.68
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
309 311 5.336102 ACAGGAAAGTGAAATCCAATCCAT 58.664 37.500 0.00 0.0 38.23 3.41
421 424 6.342111 GGGTTATTCTGTTCCACTTCTAGAG 58.658 44.000 0.00 0.0 0.00 2.43
447 450 7.392113 ACAAACGTATGATCATTACCCTTCAAA 59.608 33.333 14.65 0.0 0.00 2.69
470 473 3.369175 TGGGCCATACAATGCATTACAA 58.631 40.909 12.53 0.6 0.00 2.41
513 516 2.304761 AGCCATCGACTACCTGGAAAAA 59.695 45.455 6.18 0.0 31.38 1.94
571 574 5.649782 AGACAGAAATAAAGCATTGGGTG 57.350 39.130 0.00 0.0 0.00 4.61
676 679 6.265422 GGGAAAGTCGATTTATGGATGGATTT 59.735 38.462 0.00 0.0 0.00 2.17
678 681 5.073691 AGGGAAAGTCGATTTATGGATGGAT 59.926 40.000 0.00 0.0 0.00 3.41
744 747 9.650371 CATTCGTACCATAACATAAGAACAATG 57.350 33.333 0.00 0.0 0.00 2.82
770 773 7.874016 TCCATACATAACGAATTGGTATGGTAC 59.126 37.037 21.76 0.0 45.91 3.34
907 910 1.533129 GGCTTAATGGTTAAAGCGCCG 60.533 52.381 2.29 0.0 28.48 6.46
1072 1075 9.695526 CTTGATACCTCTCAATATCTCTTTCAG 57.304 37.037 0.00 0.0 34.76 3.02
1163 1166 7.961326 ACCAAGGTCATTCTTTGCTAAATAT 57.039 32.000 0.00 0.0 32.75 1.28
1321 1324 6.326323 ACACAAGGTTTGGGAATAAGTGATTT 59.674 34.615 0.00 0.0 37.55 2.17
1968 1973 4.087892 ATCTTGCGCGGCAGGTCT 62.088 61.111 8.83 0.0 40.61 3.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.