Multiple sequence alignment - TraesCS4D01G043900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G043900 chr4D 100.000 2241 0 0 1 2241 19928700 19926460 0 4139
1 TraesCS4D01G043900 chr5D 97.909 1578 27 4 1 1577 503218343 503216771 0 2726
2 TraesCS4D01G043900 chr5D 97.592 1578 32 4 1 1577 6189065 6187493 0 2699
3 TraesCS4D01G043900 chr5D 97.464 1577 35 3 1 1577 503278101 503279672 0 2686
4 TraesCS4D01G043900 chr5D 97.876 659 14 0 1583 2241 503216539 503215881 0 1140
5 TraesCS4D01G043900 chr5D 97.420 659 14 2 1583 2241 329121786 329122441 0 1120
6 TraesCS4D01G043900 chrUn 97.845 1578 28 4 1 1577 93409506 93411078 0 2721
7 TraesCS4D01G043900 chrUn 97.719 1578 31 3 1 1577 216518477 216520050 0 2710
8 TraesCS4D01G043900 chrUn 98.485 660 9 1 1583 2241 93411310 93411969 0 1162
9 TraesCS4D01G043900 chr6D 97.845 1578 29 3 1 1577 168255051 168253478 0 2721
10 TraesCS4D01G043900 chr6D 97.879 660 13 1 1583 2241 168249861 168249202 0 1140
11 TraesCS4D01G043900 chr3D 97.655 1578 30 5 1 1577 589279417 589280988 0 2702
12 TraesCS4D01G043900 chr2D 97.592 1578 33 3 1 1577 272793768 272795341 0 2699
13 TraesCS4D01G043900 chr2D 98.030 660 11 2 1583 2241 272795573 272796231 0 1146
14 TraesCS4D01G043900 chr3B 97.529 1578 33 4 1 1577 201527149 201525577 0 2693
15 TraesCS4D01G043900 chr1D 97.876 659 12 2 1583 2241 254524392 254523736 0 1138
16 TraesCS4D01G043900 chr3A 97.576 660 14 2 1583 2241 672911688 672912346 0 1129
17 TraesCS4D01G043900 chr6A 96.813 659 19 2 1583 2241 271188095 271187439 0 1099
18 TraesCS4D01G043900 chr2A 96.813 659 20 1 1583 2241 335829217 335828560 0 1099


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G043900 chr4D 19926460 19928700 2240 True 4139.0 4139 100.0000 1 2241 1 chr4D.!!$R1 2240
1 TraesCS4D01G043900 chr5D 6187493 6189065 1572 True 2699.0 2699 97.5920 1 1577 1 chr5D.!!$R1 1576
2 TraesCS4D01G043900 chr5D 503278101 503279672 1571 False 2686.0 2686 97.4640 1 1577 1 chr5D.!!$F2 1576
3 TraesCS4D01G043900 chr5D 503215881 503218343 2462 True 1933.0 2726 97.8925 1 2241 2 chr5D.!!$R2 2240
4 TraesCS4D01G043900 chr5D 329121786 329122441 655 False 1120.0 1120 97.4200 1583 2241 1 chr5D.!!$F1 658
5 TraesCS4D01G043900 chrUn 216518477 216520050 1573 False 2710.0 2710 97.7190 1 1577 1 chrUn.!!$F1 1576
6 TraesCS4D01G043900 chrUn 93409506 93411969 2463 False 1941.5 2721 98.1650 1 2241 2 chrUn.!!$F2 2240
7 TraesCS4D01G043900 chr6D 168249202 168255051 5849 True 1930.5 2721 97.8620 1 2241 2 chr6D.!!$R1 2240
8 TraesCS4D01G043900 chr3D 589279417 589280988 1571 False 2702.0 2702 97.6550 1 1577 1 chr3D.!!$F1 1576
9 TraesCS4D01G043900 chr2D 272793768 272796231 2463 False 1922.5 2699 97.8110 1 2241 2 chr2D.!!$F1 2240
10 TraesCS4D01G043900 chr3B 201525577 201527149 1572 True 2693.0 2693 97.5290 1 1577 1 chr3B.!!$R1 1576
11 TraesCS4D01G043900 chr1D 254523736 254524392 656 True 1138.0 1138 97.8760 1583 2241 1 chr1D.!!$R1 658
12 TraesCS4D01G043900 chr3A 672911688 672912346 658 False 1129.0 1129 97.5760 1583 2241 1 chr3A.!!$F1 658
13 TraesCS4D01G043900 chr6A 271187439 271188095 656 True 1099.0 1099 96.8130 1583 2241 1 chr6A.!!$R1 658
14 TraesCS4D01G043900 chr2A 335828560 335829217 657 True 1099.0 1099 96.8130 1583 2241 1 chr2A.!!$R1 658

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
912 914 0.032515 CAACCCCTTGGGGTTATCCC 60.033 60.0 34.97 0.0 42.24 3.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1940 5558 3.453424 GTTGTGCGAACCAAAAGGAATT 58.547 40.909 0.0 0.0 0.0 2.17 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
35 36 1.317613 AACGGCAGCAAGTGATTGAA 58.682 45.000 0.00 0.00 0.00 2.69
153 154 4.444876 CCTTGTTTCAAAGAGAGGAGGACA 60.445 45.833 0.00 0.00 0.00 4.02
203 204 3.917988 AGGCAAATTGAAAGCTAAGCAC 58.082 40.909 0.00 0.00 0.00 4.40
220 221 3.190439 AGCACTGGTAATTAAGACCCCT 58.810 45.455 6.83 0.00 35.99 4.79
274 275 6.269077 ACCCATAATATGTGGAAGTATCGACA 59.731 38.462 12.60 0.00 46.37 4.35
365 366 9.303116 GAGACCTAGGATGTAGAAGATCATAAA 57.697 37.037 17.98 0.00 0.00 1.40
798 799 2.224066 CGGATCTAAGTGTTGGCTAGGG 60.224 54.545 0.00 0.00 0.00 3.53
912 914 0.032515 CAACCCCTTGGGGTTATCCC 60.033 60.000 34.97 0.00 42.24 3.85
975 978 4.288531 CGATAGTTTTATCCTTCGTCGCT 58.711 43.478 0.00 0.00 33.52 4.93
988 991 7.263100 TCCTTCGTCGCTATAAGTAAATACA 57.737 36.000 0.00 0.00 0.00 2.29
1063 1066 0.395312 ACGACAGGAATTGAACCCGT 59.605 50.000 0.00 0.00 0.00 5.28
1230 1234 8.264347 AGAATGCCACTCTTTAAAAAGGAAAAA 58.736 29.630 2.77 0.00 36.67 1.94
1543 1548 7.310664 TCGTCGTTAACTGAATTCTGAATAGT 58.689 34.615 18.13 4.57 0.00 2.12
1753 5369 2.828520 AGAAATTCAGACCTCGAGCTCA 59.171 45.455 15.40 0.00 0.00 4.26
2082 5701 5.923733 ATAGAATCAGACTCAAGTTCCGT 57.076 39.130 0.00 0.00 0.00 4.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
203 204 2.174854 CCCCAGGGGTCTTAATTACCAG 59.825 54.545 18.09 0.0 38.25 4.00
220 221 2.783510 GAGACATCCCTATTTTCCCCCA 59.216 50.000 0.00 0.0 0.00 4.96
365 366 1.959042 AATCTGCCGAATCGCTCATT 58.041 45.000 0.00 0.0 0.00 2.57
444 445 8.097662 TGTATATGACGATCTCTAGACAGATGT 58.902 37.037 0.00 0.0 32.94 3.06
798 799 1.470458 CCTCTTACTACGGGGCGTTTC 60.470 57.143 0.00 0.0 41.54 2.78
855 856 1.767692 GGGAGCTTTCCCTTCACCA 59.232 57.895 3.72 0.0 46.39 4.17
912 914 1.656095 CTAGTTCTTCTTCCAAGCGCG 59.344 52.381 0.00 0.0 0.00 6.86
946 948 9.570488 GACGAAGGATAAAACTATCGCTATATT 57.430 33.333 0.00 0.0 33.88 1.28
947 949 7.909121 CGACGAAGGATAAAACTATCGCTATAT 59.091 37.037 0.00 0.0 33.88 0.86
965 968 9.616634 TTATGTATTTACTTATAGCGACGAAGG 57.383 33.333 0.00 0.0 0.00 3.46
1049 1052 1.176527 CATGCACGGGTTCAATTCCT 58.823 50.000 0.00 0.0 0.00 3.36
1230 1234 5.241662 GTGTCAGAGCTGATTACTCCTTTT 58.758 41.667 3.19 0.0 42.18 2.27
1231 1235 4.619394 CGTGTCAGAGCTGATTACTCCTTT 60.619 45.833 3.19 0.0 42.18 3.11
1577 1582 8.725148 GGCATGAGGTTCAGTATCATAAATAAG 58.275 37.037 0.00 0.0 32.51 1.73
1579 1584 7.017551 AGGGCATGAGGTTCAGTATCATAAATA 59.982 37.037 0.00 0.0 32.51 1.40
1581 1586 5.132648 AGGGCATGAGGTTCAGTATCATAAA 59.867 40.000 0.00 0.0 32.51 1.40
1940 5558 3.453424 GTTGTGCGAACCAAAAGGAATT 58.547 40.909 0.00 0.0 0.00 2.17


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.