Multiple sequence alignment - TraesCS4D01G043700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G043700 chr4D 100.000 2216 0 0 1 2216 19928388 19926173 0 4093
1 TraesCS4D01G043700 chrUn 97.788 1266 22 4 1 1265 93409818 93411078 0 2178
2 TraesCS4D01G043700 chrUn 97.709 1266 24 3 1 1265 216521577 216520316 0 2172
3 TraesCS4D01G043700 chrUn 97.630 1266 25 3 1 1265 216518789 216520050 0 2167
4 TraesCS4D01G043700 chrUn 97.630 1266 24 4 1 1265 396205547 396206807 0 2167
5 TraesCS4D01G043700 chrUn 98.205 947 16 1 1271 2216 93411310 93412256 0 1653
6 TraesCS4D01G043700 chr5D 97.788 1266 22 4 1 1265 503218031 503216771 0 2178
7 TraesCS4D01G043700 chr5D 97.551 1266 25 4 1 1265 6188753 6187493 0 2161
8 TraesCS4D01G043700 chr5D 97.780 946 21 0 1271 2216 503216539 503215594 0 1631
9 TraesCS4D01G043700 chr5D 97.254 947 22 3 1271 2216 329121786 329122729 0 1602
10 TraesCS4D01G043700 chr6D 97.709 1266 24 3 1 1265 168251951 168253212 0 2172
11 TraesCS4D01G043700 chr6D 97.709 1266 24 3 1 1265 168254739 168253478 0 2172
12 TraesCS4D01G043700 chr6D 97.782 947 20 1 1271 2216 168249861 168248915 0 1631
13 TraesCS4D01G043700 chr3D 97.630 1266 23 5 1 1265 589279729 589280988 0 2165
14 TraesCS4D01G043700 chr2D 97.994 947 17 2 1271 2216 272795573 272796518 0 1642
15 TraesCS4D01G043700 chr3A 97.466 947 21 3 1271 2216 672911688 672912632 0 1613
16 TraesCS4D01G043700 chr2A 96.614 945 31 1 1271 2215 335829217 335828274 0 1567
17 TraesCS4D01G043700 chr6A 96.512 946 31 2 1271 2216 271188095 271187152 0 1563
18 TraesCS4D01G043700 chr6A 96.215 951 28 5 1271 2216 260117959 260118906 0 1550


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G043700 chr4D 19926173 19928388 2215 True 4093.0 4093 100.0000 1 2216 1 chr4D.!!$R1 2215
1 TraesCS4D01G043700 chrUn 216520316 216521577 1261 True 2172.0 2172 97.7090 1 1265 1 chrUn.!!$R1 1264
2 TraesCS4D01G043700 chrUn 216518789 216520050 1261 False 2167.0 2167 97.6300 1 1265 1 chrUn.!!$F1 1264
3 TraesCS4D01G043700 chrUn 396205547 396206807 1260 False 2167.0 2167 97.6300 1 1265 1 chrUn.!!$F2 1264
4 TraesCS4D01G043700 chrUn 93409818 93412256 2438 False 1915.5 2178 97.9965 1 2216 2 chrUn.!!$F3 2215
5 TraesCS4D01G043700 chr5D 6187493 6188753 1260 True 2161.0 2161 97.5510 1 1265 1 chr5D.!!$R1 1264
6 TraesCS4D01G043700 chr5D 503215594 503218031 2437 True 1904.5 2178 97.7840 1 2216 2 chr5D.!!$R2 2215
7 TraesCS4D01G043700 chr5D 329121786 329122729 943 False 1602.0 1602 97.2540 1271 2216 1 chr5D.!!$F1 945
8 TraesCS4D01G043700 chr6D 168251951 168253212 1261 False 2172.0 2172 97.7090 1 1265 1 chr6D.!!$F1 1264
9 TraesCS4D01G043700 chr6D 168248915 168254739 5824 True 1901.5 2172 97.7455 1 2216 2 chr6D.!!$R1 2215
10 TraesCS4D01G043700 chr3D 589279729 589280988 1259 False 2165.0 2165 97.6300 1 1265 1 chr3D.!!$F1 1264
11 TraesCS4D01G043700 chr2D 272795573 272796518 945 False 1642.0 1642 97.9940 1271 2216 1 chr2D.!!$F1 945
12 TraesCS4D01G043700 chr3A 672911688 672912632 944 False 1613.0 1613 97.4660 1271 2216 1 chr3A.!!$F1 945
13 TraesCS4D01G043700 chr2A 335828274 335829217 943 True 1567.0 1567 96.6140 1271 2215 1 chr2A.!!$R1 944
14 TraesCS4D01G043700 chr6A 271187152 271188095 943 True 1563.0 1563 96.5120 1271 2216 1 chr6A.!!$R1 945
15 TraesCS4D01G043700 chr6A 260117959 260118906 947 False 1550.0 1550 96.2150 1271 2216 1 chr6A.!!$F1 945

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
600 602 0.032515 CAACCCCTTGGGGTTATCCC 60.033 60.0 34.97 0.0 42.24 3.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2182 5805 2.656947 TTGTTTGGAGGGGAAGTCTG 57.343 50.0 0.0 0.0 0.0 3.51 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
53 54 9.303116 GAGACCTAGGATGTAGAAGATCATAAA 57.697 37.037 17.98 0.00 0.00 1.40
486 487 2.224066 CGGATCTAAGTGTTGGCTAGGG 60.224 54.545 0.00 0.00 0.00 3.53
600 602 0.032515 CAACCCCTTGGGGTTATCCC 60.033 60.000 34.97 0.00 42.24 3.85
663 665 4.288531 CGATAGTTTTATCCTTCGTCGCT 58.711 43.478 0.00 0.00 33.52 4.93
676 678 7.263100 TCCTTCGTCGCTATAAGTAAATACA 57.737 36.000 0.00 0.00 0.00 2.29
751 753 0.395312 ACGACAGGAATTGAACCCGT 59.605 50.000 0.00 0.00 0.00 5.28
918 920 8.264347 AGAATGCCACTCTTTAAAAAGGAAAAA 58.736 29.630 2.77 0.00 36.67 1.94
1231 1235 7.310664 TCGTCGTTAACTGAATTCTGAATAGT 58.689 34.615 18.13 4.57 0.00 2.12
1441 5059 2.828520 AGAAATTCAGACCTCGAGCTCA 59.171 45.455 15.40 0.00 0.00 4.26
1770 5390 5.923733 ATAGAATCAGACTCAAGTTCCGT 57.076 39.130 0.00 0.00 0.00 4.69
2028 5650 7.736447 AGCCTAACATTCTTGCAGAATATAC 57.264 36.000 9.96 1.09 42.67 1.47
2182 5805 3.852205 GCGCCGAATCTATTAAAAAGGGC 60.852 47.826 0.00 0.00 34.78 5.19
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
53 54 1.959042 AATCTGCCGAATCGCTCATT 58.041 45.000 0.00 0.0 0.00 2.57
132 133 8.097662 TGTATATGACGATCTCTAGACAGATGT 58.902 37.037 0.00 0.0 32.94 3.06
486 487 1.470458 CCTCTTACTACGGGGCGTTTC 60.470 57.143 0.00 0.0 41.54 2.78
543 544 1.767692 GGGAGCTTTCCCTTCACCA 59.232 57.895 3.72 0.0 46.39 4.17
600 602 1.656095 CTAGTTCTTCTTCCAAGCGCG 59.344 52.381 0.00 0.0 0.00 6.86
634 636 9.570488 GACGAAGGATAAAACTATCGCTATATT 57.430 33.333 0.00 0.0 33.88 1.28
635 637 7.909121 CGACGAAGGATAAAACTATCGCTATAT 59.091 37.037 0.00 0.0 33.88 0.86
653 655 9.616634 TTATGTATTTACTTATAGCGACGAAGG 57.383 33.333 0.00 0.0 0.00 3.46
737 739 1.176527 CATGCACGGGTTCAATTCCT 58.823 50.000 0.00 0.0 0.00 3.36
918 920 5.241662 GTGTCAGAGCTGATTACTCCTTTT 58.758 41.667 3.19 0.0 42.18 2.27
919 921 4.619394 CGTGTCAGAGCTGATTACTCCTTT 60.619 45.833 3.19 0.0 42.18 3.11
1265 1269 8.725148 GGCATGAGGTTCAGTATCATAAATAAG 58.275 37.037 0.00 0.0 32.51 1.73
1267 1271 7.017551 AGGGCATGAGGTTCAGTATCATAAATA 59.982 37.037 0.00 0.0 32.51 1.40
1269 1273 5.132648 AGGGCATGAGGTTCAGTATCATAAA 59.867 40.000 0.00 0.0 32.51 1.40
1628 5247 3.453424 GTTGTGCGAACCAAAAGGAATT 58.547 40.909 0.00 0.0 0.00 2.17
2182 5805 2.656947 TTGTTTGGAGGGGAAGTCTG 57.343 50.000 0.00 0.0 0.00 3.51


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.