Multiple sequence alignment - TraesCS4D01G043600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G043600 chr4D 100.000 2411 0 0 1 2411 19924884 19922474 0 4453
1 TraesCS4D01G043600 chrUn 96.383 2433 55 14 1 2411 93415916 93418337 0 3975
2 TraesCS4D01G043600 chrUn 95.760 1415 34 10 1010 2411 327660468 327661869 0 2257
3 TraesCS4D01G043600 chrUn 95.055 991 27 10 1432 2411 407706425 407707404 0 1539
4 TraesCS4D01G043600 chr5D 96.382 2432 55 15 1 2411 560880898 560878479 0 3973
5 TraesCS4D01G043600 chr5D 94.735 2431 63 18 1 2411 503214304 503211919 0 3720
6 TraesCS4D01G043600 chr5D 95.554 1642 49 9 2 1635 329124002 329125627 0 2606
7 TraesCS4D01G043600 chr2D 96.094 2432 61 12 1 2411 272797805 272800223 0 3934
8 TraesCS4D01G043600 chr3B 95.916 2424 72 15 1 2411 201523096 201520687 0 3903
9 TraesCS4D01G043600 chr3A 95.620 2420 75 13 1 2411 672913920 672916317 0 3853
10 TraesCS4D01G043600 chr6A 95.579 2420 75 13 1 2411 271185859 271183463 0 3847
11 TraesCS4D01G043600 chr1A 94.339 2420 100 15 1 2411 168442211 168444602 0 3675
12 TraesCS4D01G043600 chr7B 94.026 2427 83 16 1 2407 559141407 559139023 0 3622
13 TraesCS4D01G043600 chr1D 95.925 1816 47 13 609 2411 144238516 144236715 0 2918
14 TraesCS4D01G043600 chr2B 94.322 1726 71 10 1 1716 369624132 369622424 0 2619


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G043600 chr4D 19922474 19924884 2410 True 4453 4453 100.000 1 2411 1 chr4D.!!$R1 2410
1 TraesCS4D01G043600 chrUn 93415916 93418337 2421 False 3975 3975 96.383 1 2411 1 chrUn.!!$F1 2410
2 TraesCS4D01G043600 chrUn 327660468 327661869 1401 False 2257 2257 95.760 1010 2411 1 chrUn.!!$F2 1401
3 TraesCS4D01G043600 chrUn 407706425 407707404 979 False 1539 1539 95.055 1432 2411 1 chrUn.!!$F3 979
4 TraesCS4D01G043600 chr5D 560878479 560880898 2419 True 3973 3973 96.382 1 2411 1 chr5D.!!$R2 2410
5 TraesCS4D01G043600 chr5D 503211919 503214304 2385 True 3720 3720 94.735 1 2411 1 chr5D.!!$R1 2410
6 TraesCS4D01G043600 chr5D 329124002 329125627 1625 False 2606 2606 95.554 2 1635 1 chr5D.!!$F1 1633
7 TraesCS4D01G043600 chr2D 272797805 272800223 2418 False 3934 3934 96.094 1 2411 1 chr2D.!!$F1 2410
8 TraesCS4D01G043600 chr3B 201520687 201523096 2409 True 3903 3903 95.916 1 2411 1 chr3B.!!$R1 2410
9 TraesCS4D01G043600 chr3A 672913920 672916317 2397 False 3853 3853 95.620 1 2411 1 chr3A.!!$F1 2410
10 TraesCS4D01G043600 chr6A 271183463 271185859 2396 True 3847 3847 95.579 1 2411 1 chr6A.!!$R1 2410
11 TraesCS4D01G043600 chr1A 168442211 168444602 2391 False 3675 3675 94.339 1 2411 1 chr1A.!!$F1 2410
12 TraesCS4D01G043600 chr7B 559139023 559141407 2384 True 3622 3622 94.026 1 2407 1 chr7B.!!$R1 2406
13 TraesCS4D01G043600 chr1D 144236715 144238516 1801 True 2918 2918 95.925 609 2411 1 chr1D.!!$R1 1802
14 TraesCS4D01G043600 chr2B 369622424 369624132 1708 True 2619 2619 94.322 1 1716 1 chr2B.!!$R1 1715

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
886 907 4.030134 ACTAGTAGGCGAAATTGAGACG 57.97 45.455 1.45 0.0 0.0 4.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2093 2142 2.568062 TGGAACATTTCAGCGGGTACTA 59.432 45.455 0.0 0.0 0.0 1.82 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
524 544 4.411927 TCAGGCCCTTTTAAATGTAGCAA 58.588 39.130 0.00 0.32 0.00 3.91
564 584 6.678663 CGAAAATTGATGTGTATTCGAGTCAC 59.321 38.462 0.00 8.90 41.39 3.67
668 688 6.641474 CCTCTAGAAAGGTCCGAAGTAATTT 58.359 40.000 0.00 0.00 0.00 1.82
809 829 4.873129 GCGCGATTGCCGAGGAGA 62.873 66.667 12.10 0.00 41.76 3.71
886 907 4.030134 ACTAGTAGGCGAAATTGAGACG 57.970 45.455 1.45 0.00 0.00 4.18
1019 1050 4.227300 TCTTATGGGCAAGGACACTATTGT 59.773 41.667 0.00 0.00 39.32 2.71
1150 1181 6.926826 GGGTTTTATTGAAAGTGTTCGGAAAT 59.073 34.615 0.00 0.00 36.46 2.17
1151 1182 7.095816 GGGTTTTATTGAAAGTGTTCGGAAATG 60.096 37.037 0.00 0.00 36.46 2.32
1208 1240 4.997905 TGCGACATCAAAAGAGAAAGAG 57.002 40.909 0.00 0.00 0.00 2.85
1358 1390 6.322456 ACTTCTCGAGGAATAATGACAGATCA 59.678 38.462 13.56 0.00 34.58 2.92
1646 1687 8.816894 CCTAGGCTATATTTCAGGAAAGATACA 58.183 37.037 0.00 0.00 34.49 2.29
1657 1698 9.658799 TTTCAGGAAAGATACATTCTAGTTCTG 57.341 33.333 0.00 0.00 33.05 3.02
1720 1761 4.394920 GTCGTTATGATTCAAGCAAGGGAA 59.605 41.667 0.00 0.00 0.00 3.97
1757 1798 2.123589 TCCCCATAAGGATTCGAAGCA 58.876 47.619 16.24 0.00 38.24 3.91
1801 1842 4.212214 GCGAAGATTTGAAGGATAGCGAAT 59.788 41.667 0.00 0.00 0.00 3.34
1839 1880 8.367911 ACCAAAGATTCAAAGGATTAGGTTTTC 58.632 33.333 0.00 0.00 0.00 2.29
1993 2039 6.852858 TTGTACAAAATGTCGACTGATTCA 57.147 33.333 17.92 6.15 0.00 2.57
2024 2070 4.026475 GGACGAATTAGAGTCATTTGCTCG 60.026 45.833 9.46 0.00 39.01 5.03
2103 2154 9.506018 TTCTAAAAAGTAAAAATAGTACCCGCT 57.494 29.630 0.00 0.00 0.00 5.52
2282 2338 2.907634 TGGTTCACGTAAGAAAGTGCA 58.092 42.857 0.00 0.00 43.62 4.57
2317 2373 6.768078 CGTAGGAATGCACGTTTTAGTTTAT 58.232 36.000 0.00 0.00 33.56 1.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
20 21 1.398390 CTCGGCAGGATTTTCCTTTCG 59.602 52.381 8.26 8.26 46.91 3.46
104 113 3.764434 TCTTCGTCCTGCTTCTATCTGTT 59.236 43.478 0.00 0.00 0.00 3.16
524 544 8.562892 CATCAATTTTCGAGCTCCACTATTATT 58.437 33.333 8.47 0.00 0.00 1.40
593 613 6.208402 ACAGCAACAATAACATCACCAATACA 59.792 34.615 0.00 0.00 0.00 2.29
668 688 5.716094 ACATGTACGTACAATTACAGCTCA 58.284 37.500 30.46 4.57 39.99 4.26
741 761 6.533367 GCCTTTTTGATCAATTATAACCGCAA 59.467 34.615 9.40 0.00 0.00 4.85
995 1026 5.103940 ACAATAGTGTCCTTGCCCATAAGAT 60.104 40.000 0.00 0.00 29.49 2.40
1114 1145 7.935210 ACTTTCAATAAAACCCTCTCGTAGAAA 59.065 33.333 0.00 0.00 34.09 2.52
1150 1181 9.166173 CAAGAAATATCTGTTATGTTCCTGACA 57.834 33.333 0.00 0.00 38.19 3.58
1151 1182 8.616076 CCAAGAAATATCTGTTATGTTCCTGAC 58.384 37.037 0.00 0.00 35.59 3.51
1358 1390 5.409826 CCAATTCTGTTTAGTCGAGCTTCTT 59.590 40.000 0.00 0.00 0.00 2.52
1544 1579 6.788243 TCCAAACCTTCGAAAGTTACTTTTC 58.212 36.000 12.35 4.82 33.49 2.29
1594 1635 1.134560 GGTGTCGTTCTCTAGCCGAAT 59.865 52.381 0.00 0.00 31.68 3.34
1608 1649 1.043816 AGCCTAGGATGATGGTGTCG 58.956 55.000 14.75 0.00 0.00 4.35
1646 1687 8.353684 CCATCAGTATTCGTACAGAACTAGAAT 58.646 37.037 0.00 0.00 42.39 2.40
1647 1688 7.201794 CCCATCAGTATTCGTACAGAACTAGAA 60.202 40.741 0.00 0.00 42.39 2.10
1657 1698 4.159879 CCTATCCCCCATCAGTATTCGTAC 59.840 50.000 0.00 0.00 0.00 3.67
1765 1806 5.298527 TCAAATCTTCGCTATCCTTCGAGTA 59.701 40.000 0.00 0.00 36.02 2.59
1993 2039 2.957006 ACTCTAATTCGTCCACGCCTAT 59.043 45.455 0.00 0.00 39.60 2.57
2024 2070 5.938322 TGTCTTTGTTTATGCTTCGGATTC 58.062 37.500 0.00 0.00 0.00 2.52
2093 2142 2.568062 TGGAACATTTCAGCGGGTACTA 59.432 45.455 0.00 0.00 0.00 1.82
2282 2338 5.235616 CGTGCATTCCTACGTAAACCAATAT 59.764 40.000 0.00 0.00 35.70 1.28
2317 2373 4.021807 TGTTATTCTACGTGCACTCTTCCA 60.022 41.667 16.19 0.00 0.00 3.53


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.