Multiple sequence alignment - TraesCS4D01G043500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G043500 chr4D 100.000 2968 0 0 1 2968 19923645 19920678 0.000000e+00 5481
1 TraesCS4D01G043500 chrUn 96.304 3003 65 18 1 2968 93417166 93420157 0.000000e+00 4889
2 TraesCS4D01G043500 chrUn 95.953 1458 33 9 1 1445 327660698 327662142 0.000000e+00 2342
3 TraesCS4D01G043500 chrUn 95.802 1334 34 10 193 1515 407706425 407707747 0.000000e+00 2134
4 TraesCS4D01G043500 chr5D 96.237 3003 65 17 1 2968 560879650 560876661 0.000000e+00 4876
5 TraesCS4D01G043500 chr5D 95.904 3003 70 21 1 2968 503213084 503210100 0.000000e+00 4815
6 TraesCS4D01G043500 chr5D 96.091 1893 51 7 1099 2968 329196036 329194144 0.000000e+00 3064
7 TraesCS4D01G043500 chr5D 92.804 403 9 5 1 396 329125238 329125627 1.540000e-157 566
8 TraesCS4D01G043500 chr3B 95.733 3000 83 18 1 2968 201521856 201518870 0.000000e+00 4789
9 TraesCS4D01G043500 chr1A 94.420 2993 108 30 1 2963 168443442 168446405 0.000000e+00 4547
10 TraesCS4D01G043500 chr6A 93.927 2997 119 23 1 2968 260125622 260128584 0.000000e+00 4468
11 TraesCS4D01G043500 chr6A 95.088 2789 94 17 1 2761 271184628 271181855 0.000000e+00 4351
12 TraesCS4D01G043500 chr1D 95.865 2491 57 21 1 2458 144237888 144235411 0.000000e+00 3988
13 TraesCS4D01G043500 chr1D 95.957 1682 44 8 1137 2795 254504905 254503225 0.000000e+00 2708
14 TraesCS4D01G043500 chr7A 95.128 2155 70 14 838 2968 201367984 201370127 0.000000e+00 3365
15 TraesCS4D01G043500 chr7A 94.924 788 24 6 1 784 201367214 201367989 0.000000e+00 1219
16 TraesCS4D01G043500 chr3A 94.085 1961 66 22 1 1930 692572983 692571042 0.000000e+00 2933
17 TraesCS4D01G043500 chr3A 94.558 1856 52 18 1 1828 672915159 672916993 0.000000e+00 2822
18 TraesCS4D01G043500 chr2D 95.953 1458 33 9 1 1445 272799052 272800496 0.000000e+00 2342
19 TraesCS4D01G043500 chr4A 94.935 1224 38 8 1 1214 722779710 722780919 0.000000e+00 1895
20 TraesCS4D01G043500 chr6D 91.604 667 16 7 1 658 168246383 168245748 0.000000e+00 885
21 TraesCS4D01G043500 chr2A 94.845 97 5 0 2870 2966 284007700 284007604 5.120000e-33 152


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G043500 chr4D 19920678 19923645 2967 True 5481 5481 100.000 1 2968 1 chr4D.!!$R1 2967
1 TraesCS4D01G043500 chrUn 93417166 93420157 2991 False 4889 4889 96.304 1 2968 1 chrUn.!!$F1 2967
2 TraesCS4D01G043500 chrUn 327660698 327662142 1444 False 2342 2342 95.953 1 1445 1 chrUn.!!$F2 1444
3 TraesCS4D01G043500 chrUn 407706425 407707747 1322 False 2134 2134 95.802 193 1515 1 chrUn.!!$F3 1322
4 TraesCS4D01G043500 chr5D 560876661 560879650 2989 True 4876 4876 96.237 1 2968 1 chr5D.!!$R3 2967
5 TraesCS4D01G043500 chr5D 503210100 503213084 2984 True 4815 4815 95.904 1 2968 1 chr5D.!!$R2 2967
6 TraesCS4D01G043500 chr5D 329194144 329196036 1892 True 3064 3064 96.091 1099 2968 1 chr5D.!!$R1 1869
7 TraesCS4D01G043500 chr3B 201518870 201521856 2986 True 4789 4789 95.733 1 2968 1 chr3B.!!$R1 2967
8 TraesCS4D01G043500 chr1A 168443442 168446405 2963 False 4547 4547 94.420 1 2963 1 chr1A.!!$F1 2962
9 TraesCS4D01G043500 chr6A 260125622 260128584 2962 False 4468 4468 93.927 1 2968 1 chr6A.!!$F1 2967
10 TraesCS4D01G043500 chr6A 271181855 271184628 2773 True 4351 4351 95.088 1 2761 1 chr6A.!!$R1 2760
11 TraesCS4D01G043500 chr1D 144235411 144237888 2477 True 3988 3988 95.865 1 2458 1 chr1D.!!$R1 2457
12 TraesCS4D01G043500 chr1D 254503225 254504905 1680 True 2708 2708 95.957 1137 2795 1 chr1D.!!$R2 1658
13 TraesCS4D01G043500 chr7A 201367214 201370127 2913 False 2292 3365 95.026 1 2968 2 chr7A.!!$F1 2967
14 TraesCS4D01G043500 chr3A 692571042 692572983 1941 True 2933 2933 94.085 1 1930 1 chr3A.!!$R1 1929
15 TraesCS4D01G043500 chr3A 672915159 672916993 1834 False 2822 2822 94.558 1 1828 1 chr3A.!!$F1 1827
16 TraesCS4D01G043500 chr2D 272799052 272800496 1444 False 2342 2342 95.953 1 1445 1 chr2D.!!$F1 1444
17 TraesCS4D01G043500 chr4A 722779710 722780919 1209 False 1895 1895 94.935 1 1214 1 chr4A.!!$F1 1213
18 TraesCS4D01G043500 chr6D 168245748 168246383 635 True 885 885 91.604 1 658 1 chr6D.!!$R1 657

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
518 526 2.123589 TCCCCATAAGGATTCGAAGCA 58.876 47.619 16.24 0.0 38.24 3.91 F
1043 1072 2.907634 TGGTTCACGTAAGAAAGTGCA 58.092 42.857 0.00 0.0 43.62 4.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1371 1400 0.232303 GCATAGGTGTTACATCGCGC 59.768 55.0 0.0 0.0 0.0 6.86 R
2803 2865 0.173255 CAAAATCCATTTCGCCGCCT 59.827 50.0 0.0 0.0 0.0 5.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
119 120 6.322456 ACTTCTCGAGGAATAATGACAGATCA 59.678 38.462 13.56 0.00 34.58 2.92
407 415 8.816894 CCTAGGCTATATTTCAGGAAAGATACA 58.183 37.037 0.00 0.00 34.49 2.29
418 426 9.658799 TTTCAGGAAAGATACATTCTAGTTCTG 57.341 33.333 0.00 0.00 33.05 3.02
481 489 4.394920 GTCGTTATGATTCAAGCAAGGGAA 59.605 41.667 0.00 0.00 0.00 3.97
518 526 2.123589 TCCCCATAAGGATTCGAAGCA 58.876 47.619 16.24 0.00 38.24 3.91
562 570 4.212214 GCGAAGATTTGAAGGATAGCGAAT 59.788 41.667 0.00 0.00 0.00 3.34
600 608 8.367911 ACCAAAGATTCAAAGGATTAGGTTTTC 58.632 33.333 0.00 0.00 0.00 2.29
754 770 6.852858 TTGTACAAAATGTCGACTGATTCA 57.147 33.333 17.92 6.15 0.00 2.57
785 801 4.026475 GGACGAATTAGAGTCATTTGCTCG 60.026 45.833 9.46 0.00 39.01 5.03
864 883 9.506018 TTCTAAAAAGTAAAAATAGTACCCGCT 57.494 29.630 0.00 0.00 0.00 5.52
1043 1072 2.907634 TGGTTCACGTAAGAAAGTGCA 58.092 42.857 0.00 0.00 43.62 4.57
1371 1400 6.887376 AGTAGTGTGCGATTAAGTTGTATG 57.113 37.500 0.00 0.00 0.00 2.39
1419 1449 1.664151 GGATGTCGACCGCCTAAAAAG 59.336 52.381 14.12 0.00 0.00 2.27
1589 1639 7.042321 CGCCTTTATTATGGTCGTTTCATTCTA 60.042 37.037 0.00 0.00 0.00 2.10
1594 1644 6.494666 TTATGGTCGTTTCATTCTATCCCT 57.505 37.500 0.00 0.00 0.00 4.20
1801 1851 8.934023 AGAAGTAATCTCTATGGAGTTAGAGG 57.066 38.462 5.93 0.00 43.57 3.69
1847 1897 7.142680 GTCCTAGATACATAACTGCTCAAGAC 58.857 42.308 0.00 0.00 0.00 3.01
1910 1960 7.097192 CACAACCTATAGCTAACTTGACAGAA 58.903 38.462 0.00 0.00 0.00 3.02
1934 1984 9.090692 GAACCCATTGATTTCTGTATTGATTTG 57.909 33.333 0.00 0.00 0.00 2.32
1965 2015 5.569355 AGAGAGATCGTGGATATCAGACAT 58.431 41.667 4.83 0.00 33.30 3.06
1978 2028 8.417106 TGGATATCAGACATAACTCAGAAAGAC 58.583 37.037 4.83 0.00 0.00 3.01
2161 2216 7.020914 AGGCTTCTCGTAATTTGATTGATTC 57.979 36.000 0.00 0.00 0.00 2.52
2183 2238 5.060506 TCATTTCTTCCTTTTCTACACGCA 58.939 37.500 0.00 0.00 0.00 5.24
2248 2303 5.138758 ACTCCACCCCTTTTTACTTTTCT 57.861 39.130 0.00 0.00 0.00 2.52
2441 2496 8.480643 ACAGTTTTCGTATGGAAGATAGAAAG 57.519 34.615 0.00 0.00 35.70 2.62
2445 2500 7.715265 TTTCGTATGGAAGATAGAAAGCATC 57.285 36.000 0.00 0.00 35.70 3.91
2856 2918 9.793259 TTGACATTCTCTAGAAAAGGTATTGTT 57.207 29.630 0.00 0.00 37.61 2.83
2891 2953 6.325919 TGGCACAGAAACGATTAAAAGAAT 57.674 33.333 0.00 0.00 0.00 2.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
119 120 5.409826 CCAATTCTGTTTAGTCGAGCTTCTT 59.590 40.000 0.00 0.00 0.00 2.52
294 296 5.548181 AAGTTACTTTTCCTTCTCTCGGT 57.452 39.130 0.00 0.00 0.00 4.69
305 307 6.788243 TCCAAACCTTCGAAAGTTACTTTTC 58.212 36.000 12.35 4.82 33.49 2.29
355 363 1.134560 GGTGTCGTTCTCTAGCCGAAT 59.865 52.381 0.00 0.00 31.68 3.34
369 377 1.043816 AGCCTAGGATGATGGTGTCG 58.956 55.000 14.75 0.00 0.00 4.35
407 415 8.353684 CCATCAGTATTCGTACAGAACTAGAAT 58.646 37.037 0.00 0.00 42.39 2.40
408 416 7.201794 CCCATCAGTATTCGTACAGAACTAGAA 60.202 40.741 0.00 0.00 42.39 2.10
418 426 4.159879 CCTATCCCCCATCAGTATTCGTAC 59.840 50.000 0.00 0.00 0.00 3.67
526 534 5.298527 TCAAATCTTCGCTATCCTTCGAGTA 59.701 40.000 0.00 0.00 36.02 2.59
754 770 2.957006 ACTCTAATTCGTCCACGCCTAT 59.043 45.455 0.00 0.00 39.60 2.57
785 801 5.938322 TGTCTTTGTTTATGCTTCGGATTC 58.062 37.500 0.00 0.00 0.00 2.52
854 871 2.568062 TGGAACATTTCAGCGGGTACTA 59.432 45.455 0.00 0.00 0.00 1.82
1043 1072 5.235616 CGTGCATTCCTACGTAAACCAATAT 59.764 40.000 0.00 0.00 35.70 1.28
1351 1380 3.062099 CGCATACAACTTAATCGCACACT 59.938 43.478 0.00 0.00 0.00 3.55
1371 1400 0.232303 GCATAGGTGTTACATCGCGC 59.768 55.000 0.00 0.00 0.00 6.86
1419 1449 6.647895 TGGGTTAATTCTTTTACAGACGTCTC 59.352 38.462 16.96 0.00 0.00 3.36
1508 1538 4.034048 CACTGTAGTGTTTGAGTGAACCAC 59.966 45.833 3.88 0.00 40.96 4.16
1589 1639 4.593956 CTTGACCTTTTCTAAGCAGGGAT 58.406 43.478 0.00 0.00 31.19 3.85
1594 1644 2.151202 CCGCTTGACCTTTTCTAAGCA 58.849 47.619 0.00 0.00 44.23 3.91
1619 1669 0.320858 TTCGCAAGGCAATACCGACA 60.321 50.000 0.00 0.00 46.52 4.35
1847 1897 1.202533 ACGGAAGGCGGTAAGATGATG 60.203 52.381 0.00 0.00 0.00 3.07
1910 1960 7.043565 GCAAATCAATACAGAAATCAATGGGT 58.956 34.615 0.00 0.00 0.00 4.51
1934 1984 2.360483 TCCACGATCTCTCTTGATCTGC 59.640 50.000 0.00 0.00 40.32 4.26
1965 2015 7.619698 TCCATCTTGATAGGTCTTTCTGAGTTA 59.380 37.037 0.00 0.00 0.00 2.24
2099 2154 9.114938 TCCTTAGGGTTTAAACTTCCATTAGTA 57.885 33.333 17.50 0.00 0.00 1.82
2116 2171 4.080299 CCTCATAAAGTGCTTCCTTAGGGT 60.080 45.833 0.00 0.00 0.00 4.34
2161 2216 5.179368 TCTGCGTGTAGAAAAGGAAGAAATG 59.821 40.000 0.00 0.00 0.00 2.32
2183 2238 0.324830 AACTAGCGCCCTCTTCCTCT 60.325 55.000 2.29 0.00 0.00 3.69
2441 2496 4.402829 TCTCTAGAGTGTCCCATAGATGC 58.597 47.826 19.21 0.00 0.00 3.91
2445 2500 4.211125 TGCTTCTCTAGAGTGTCCCATAG 58.789 47.826 19.21 6.59 0.00 2.23
2803 2865 0.173255 CAAAATCCATTTCGCCGCCT 59.827 50.000 0.00 0.00 0.00 5.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.