Multiple sequence alignment - TraesCS4D01G043000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G043000 chr4D 100.000 2201 0 0 1 2201 19911118 19913318 0.000000e+00 4065.0
1 TraesCS4D01G043000 chr3D 97.383 2216 43 7 1 2201 21898694 21900909 0.000000e+00 3757.0
2 TraesCS4D01G043000 chr5D 96.016 2234 53 12 1 2201 6206685 6204455 0.000000e+00 3600.0
3 TraesCS4D01G043000 chr5D 97.287 2064 39 9 155 2201 240132461 240134524 0.000000e+00 3485.0
4 TraesCS4D01G043000 chr5D 96.939 1601 33 8 616 2201 449153933 449152334 0.000000e+00 2671.0
5 TraesCS4D01G043000 chr5D 96.310 1084 16 5 1 1062 554199862 554198781 0.000000e+00 1759.0
6 TraesCS4D01G043000 chr5D 93.939 363 5 1 1 346 554201484 554201846 1.160000e-147 532.0
7 TraesCS4D01G043000 chr3B 96.014 2233 56 9 1 2201 201507716 201509947 0.000000e+00 3600.0
8 TraesCS4D01G043000 chr2D 94.300 2263 65 13 1 2201 334227054 334229314 0.000000e+00 3406.0
9 TraesCS4D01G043000 chr1D 95.940 1921 40 23 1 1904 254490836 254492735 0.000000e+00 3081.0
10 TraesCS4D01G043000 chr1D 95.911 1712 37 9 1 1679 483921820 483920109 0.000000e+00 2743.0
11 TraesCS4D01G043000 chr1D 96.978 1423 28 7 794 2201 483919206 483917784 0.000000e+00 2375.0
12 TraesCS4D01G043000 chr1D 96.557 1307 23 4 1 1285 394180055 394181361 0.000000e+00 2145.0
13 TraesCS4D01G043000 chr1D 96.985 1161 21 7 1054 2201 254493672 254494831 0.000000e+00 1938.0
14 TraesCS4D01G043000 chr1D 96.331 954 22 6 1220 2160 254493682 254492729 0.000000e+00 1555.0
15 TraesCS4D01G043000 chrUn 95.804 1573 33 9 1 1540 317472048 317470476 0.000000e+00 2508.0
16 TraesCS4D01G043000 chrUn 96.649 1313 27 9 206 1501 412876642 412877954 0.000000e+00 2165.0
17 TraesCS4D01G043000 chr6D 96.819 1226 19 10 1 1206 431404045 431405270 0.000000e+00 2030.0
18 TraesCS4D01G043000 chr6D 96.494 1084 16 4 1 1062 431401164 431402247 0.000000e+00 1772.0
19 TraesCS4D01G043000 chr5A 94.186 172 5 1 1313 1479 666533015 666532844 7.800000e-65 257.0
20 TraesCS4D01G043000 chr2B 100.000 38 0 0 2164 2201 170513275 170513238 1.090000e-08 71.3


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G043000 chr4D 19911118 19913318 2200 False 4065.0 4065 100.0000 1 2201 1 chr4D.!!$F1 2200
1 TraesCS4D01G043000 chr3D 21898694 21900909 2215 False 3757.0 3757 97.3830 1 2201 1 chr3D.!!$F1 2200
2 TraesCS4D01G043000 chr5D 6204455 6206685 2230 True 3600.0 3600 96.0160 1 2201 1 chr5D.!!$R1 2200
3 TraesCS4D01G043000 chr5D 240132461 240134524 2063 False 3485.0 3485 97.2870 155 2201 1 chr5D.!!$F1 2046
4 TraesCS4D01G043000 chr5D 449152334 449153933 1599 True 2671.0 2671 96.9390 616 2201 1 chr5D.!!$R2 1585
5 TraesCS4D01G043000 chr5D 554198781 554199862 1081 True 1759.0 1759 96.3100 1 1062 1 chr5D.!!$R3 1061
6 TraesCS4D01G043000 chr3B 201507716 201509947 2231 False 3600.0 3600 96.0140 1 2201 1 chr3B.!!$F1 2200
7 TraesCS4D01G043000 chr2D 334227054 334229314 2260 False 3406.0 3406 94.3000 1 2201 1 chr2D.!!$F1 2200
8 TraesCS4D01G043000 chr1D 483917784 483921820 4036 True 2559.0 2743 96.4445 1 2201 2 chr1D.!!$R2 2200
9 TraesCS4D01G043000 chr1D 254490836 254494831 3995 False 2509.5 3081 96.4625 1 2201 2 chr1D.!!$F2 2200
10 TraesCS4D01G043000 chr1D 394180055 394181361 1306 False 2145.0 2145 96.5570 1 1285 1 chr1D.!!$F1 1284
11 TraesCS4D01G043000 chr1D 254492729 254493682 953 True 1555.0 1555 96.3310 1220 2160 1 chr1D.!!$R1 940
12 TraesCS4D01G043000 chrUn 317470476 317472048 1572 True 2508.0 2508 95.8040 1 1540 1 chrUn.!!$R1 1539
13 TraesCS4D01G043000 chrUn 412876642 412877954 1312 False 2165.0 2165 96.6490 206 1501 1 chrUn.!!$F1 1295
14 TraesCS4D01G043000 chr6D 431401164 431405270 4106 False 1901.0 2030 96.6565 1 1206 2 chr6D.!!$F1 1205

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
681 3583 2.017049 GATGGATTGGGTTGAACCTCG 58.983 52.381 14.87 0.0 38.64 4.63 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1980 8529 1.075536 AGGTCTGGCCCTTTCGAATTT 59.924 47.619 0.0 0.0 38.26 1.82 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
308 326 8.632731 TCCTTGGTAAAATATAGGAAGAAGGA 57.367 34.615 0.00 0.0 34.31 3.36
326 344 9.457110 GAAGAAGGAGTCATCTTTTTCTTTTTC 57.543 33.333 10.66 2.0 37.08 2.29
346 364 7.533289 TTTTCAGGGATAGGAAAATTTCGTT 57.467 32.000 6.24 0.0 37.90 3.85
621 3521 8.183536 TCGTGATATGACAAAATTTGATCCTTG 58.816 33.333 13.19 0.0 0.00 3.61
681 3583 2.017049 GATGGATTGGGTTGAACCTCG 58.983 52.381 14.87 0.0 38.64 4.63
784 3688 3.550437 ATCAGAGCATAGAAAAGGCGT 57.450 42.857 0.00 0.0 0.00 5.68
1006 3912 1.186200 GAAAAGGAGGTTCATGGCCC 58.814 55.000 0.00 0.0 0.00 5.80
1078 3984 2.351738 CGAAAAGGTGCCAATGAGGAAC 60.352 50.000 0.00 0.0 46.41 3.62
1083 3989 0.605319 GTGCCAATGAGGAACCGACA 60.605 55.000 0.00 0.0 40.49 4.35
1149 4055 6.364976 CACCCGGACAATTAGAATTCAAAAAC 59.635 38.462 0.73 0.0 0.00 2.43
1236 5945 5.418310 TCGATCTTTCCAAACAACAGAAC 57.582 39.130 0.00 0.0 0.00 3.01
1237 5946 4.878971 TCGATCTTTCCAAACAACAGAACA 59.121 37.500 0.00 0.0 0.00 3.18
1246 5955 7.083875 TCCAAACAACAGAACAAGTAAGAAG 57.916 36.000 0.00 0.0 0.00 2.85
1401 6137 7.510549 TGGATCAAAGAAAAACTACTTCTGG 57.489 36.000 0.00 0.0 33.40 3.86
1707 6456 9.443323 TGAACAAGGAAAAATATTATCGAGACA 57.557 29.630 0.00 0.0 0.00 3.41
1803 8351 6.779117 TCTTACCGTTTCGTAACTATGAGAG 58.221 40.000 3.36 0.0 31.89 3.20
1980 8529 7.881142 AGTTCCGATTGTTGATGTTTTATTCA 58.119 30.769 0.00 0.0 0.00 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
308 326 7.846101 ATCCCTGAAAAAGAAAAAGATGACT 57.154 32.000 0.00 0.00 0.00 3.41
326 344 6.699575 ATCAACGAAATTTTCCTATCCCTG 57.300 37.500 3.61 0.00 0.00 4.45
641 3541 8.539117 TCCATCTTTTCTTTCTTTTTCCTTCT 57.461 30.769 0.00 0.00 0.00 2.85
681 3583 7.604927 GGGGTTTACCAAATTTTTAATGACTCC 59.395 37.037 0.69 0.00 42.91 3.85
784 3688 5.268387 TCCTTTCATTTAATTAGCCAGCCA 58.732 37.500 0.00 0.00 0.00 4.75
1006 3912 7.108847 ACTCTGATTCTAACATCTTTTCCCTG 58.891 38.462 0.00 0.00 0.00 4.45
1078 3984 7.830201 AGTACTATATCTAGAAATCCCTGTCGG 59.170 40.741 0.00 0.00 0.00 4.79
1149 4055 3.297979 GCTTGCGACAATAACGACAAATG 59.702 43.478 0.00 0.00 0.00 2.32
1487 6236 5.131067 GGATTTACTAAAGGGTTGCCTAGG 58.869 45.833 3.67 3.67 0.00 3.02
1491 6240 4.381612 GCTTGGATTTACTAAAGGGTTGCC 60.382 45.833 0.00 0.00 0.00 4.52
1729 6478 6.314784 AGCAAGAGTAATTAATCGTTGTTGC 58.685 36.000 20.84 20.84 37.44 4.17
1803 8351 1.460743 GGGCTTGAAATTGCTTTTCGC 59.539 47.619 7.78 6.28 45.63 4.70
1980 8529 1.075536 AGGTCTGGCCCTTTCGAATTT 59.924 47.619 0.00 0.00 38.26 1.82
2027 8576 5.733620 TTAAGTGGTAGGAATCAACGAGT 57.266 39.130 0.00 0.00 0.00 4.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.