AutoCloner

Multiple sequence alignment - TraesCS4D01G039000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)

BLAST Results

Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

	qseqid	sseqid	percentage.identical	alignment.length	no.mismatch	no.gap.openings	qstart	qend	sstart	send	evalue	bitscore
0	TraesCS4D01G039000	chr4D	100.000	4819	0	0	1	4819	16792673	16797491	0.000000e+00	8900.0
1	TraesCS4D01G039000	chr4A	92.523	2247	114	20	675	2907	583763768	583761562	0.000000e+00	3169.0
2	TraesCS4D01G039000	chr4A	88.028	994	73	23	3222	4183	583760862	583759883	0.000000e+00	1134.0
3	TraesCS4D01G039000	chr4A	85.714	392	48	7	1048	1438	744427107	744427491	1.610000e-109	407.0
4	TraesCS4D01G039000	chr4A	85.953	299	29	9	2896	3189	583761154	583760864	1.680000e-79	307.0
5	TraesCS4D01G039000	chr4A	87.313	134	11	3	4686	4819	583759378	583759251	1.080000e-31	148.0
6	TraesCS4D01G039000	chr4B	94.572	1179	59	4	1981	3155	28712257	28713434	0.000000e+00	1818.0
7	TraesCS4D01G039000	chr4B	94.479	1123	37	15	3155	4258	28713539	28714655	0.000000e+00	1707.0
8	TraesCS4D01G039000	chr4B	91.559	1244	53	19	675	1889	28711021	28712241	0.000000e+00	1668.0
9	TraesCS4D01G039000	chr4B	85.714	574	42	19	4257	4815	28714686	28715234	1.950000e-158	569.0
10	TraesCS4D01G039000	chr1A	78.879	535	77	27	6	511	516170201	516170728	3.600000e-86	329.0
11	TraesCS4D01G039000	chr1A	78.476	525	63	33	6	507	238653029	238653526	1.010000e-76	298.0
12	TraesCS4D01G039000	chr1A	84.106	151	21	3	368	516	219383746	219383895	5.030000e-30	143.0
13	TraesCS4D01G039000	chr1A	73.930	257	42	18	432	676	360402743	360402500	4.000000e-11	80.5
14	TraesCS4D01G039000	chr5A	79.130	345	58	12	77	417	521748528	521748862	4.850000e-55	226.0
15	TraesCS4D01G039000	chr5D	78.736	348	60	11	73	417	410248026	410248362	2.260000e-53	220.0
16	TraesCS4D01G039000	chr5D	93.443	122	8	0	425	546	506596705	506596584	1.070000e-41	182.0
17	TraesCS4D01G039000	chr3D	93.443	122	8	0	425	546	302991785	302991664	1.070000e-41	182.0
18	TraesCS4D01G039000	chr3D	73.864	264	51	12	423	675	602053623	602053367	6.640000e-14	89.8
19	TraesCS4D01G039000	chr6A	77.570	321	49	16	372	675	85253701	85253387	6.410000e-39	172.0
20	TraesCS4D01G039000	chr6A	75.379	264	44	15	423	676	224249503	224249755	1.830000e-19	108.0
21	TraesCS4D01G039000	chr5B	75.665	263	45	12	422	668	297975810	297976069	3.940000e-21	113.0
22	TraesCS4D01G039000	chr7A	75.094	265	43	17	423	676	686230918	686230666	8.530000e-18	102.0
23	TraesCS4D01G039000	chr7A	85.106	94	10	4	426	516	497653934	497654026	5.140000e-15	93.5
24	TraesCS4D01G039000	chr7A	74.436	266	45	17	423	677	639295268	639295521	5.140000e-15	93.5
25	TraesCS4D01G039000	chr7A	74.330	261	44	17	423	672	3959257	3959505	6.640000e-14	89.8
26	TraesCS4D01G039000	chr7A	73.881	268	41	21	423	676	233341351	233341603	4.000000e-11	80.5

These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

	query	scaffold	start	end	length	rev.comp	avg.bitscore	max.bitscore	avg.percent.identical	query.start	query.end	num_hsp	groupid	homo_length
0	TraesCS4D01G039000	chr4D	16792673	16797491	4818	False	8900.0	8900	100.00000	1	4819	1	chr4D.!!$F1	4818
1	TraesCS4D01G039000	chr4A	583759251	583763768	4517	True	1189.5	3169	88.45425	675	4819	4	chr4A.!!$R1	4144
2	TraesCS4D01G039000	chr4B	28711021	28715234	4213	False	1440.5	1818	91.58100	675	4815	4	chr4B.!!$F1	4140
3	TraesCS4D01G039000	chr1A	516170201	516170728	527	False	329.0	329	78.87900	6	511	1	chr1A.!!$F3	505

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
629	678	0.031857	CTGATCTGACGGCTAGCCAG	59.968	60.0	32.47	25.43	35.37	4.85	F
1707	1799	0.037326	TAGAATGCGCCGATGGATCC	60.037	55.0	4.18	4.20	0.00	3.36	F
2486	2581	0.251564	CACCAACCCTGCCCAATACA	60.252	55.0	0.00	0.00	0.00	2.29	F

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
2349	2444	0.034670	AAGCTCTCATCAGTTGGGGC	60.035	55.000	0.00	0.00	0.00	5.80	R
3437	4067	0.245266	TGCGTCTTGCTATCGGTTGA	59.755	50.000	0.00	0.00	46.63	3.18	R
4013	4656	2.979813	GCAACGGTAACTGCAATTTCAG	59.020	45.455	3.36	3.36	37.67	3.02	R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability
71	72	2.281484	GCAACACGCAGGGGAGAA	60.281	61.111	0.00	0.00	41.79	2.87
74	75	3.553095	AACACGCAGGGGAGAAGCC	62.553	63.158	0.00	0.00	0.00	4.35
102	138	3.423154	GGCGGAACTCGGTGCTTG	61.423	66.667	0.00	0.00	39.69	4.01
106	142	1.741770	GGAACTCGGTGCTTGCGAT	60.742	57.895	0.00	0.00	0.00	4.58
141	178	2.537560	GGATCCCGTGCTTGCGATG	61.538	63.158	0.00	0.00	0.00	3.84
142	179	3.173390	GATCCCGTGCTTGCGATGC	62.173	63.158	0.00	0.00	0.00	3.91
152	189	0.649475	CTTGCGATGCAGCTACTCAC	59.351	55.000	0.00	0.00	40.61	3.51
153	190	0.247460	TTGCGATGCAGCTACTCACT	59.753	50.000	0.00	0.00	40.61	3.41
155	192	1.150567	GCGATGCAGCTACTCACTGG	61.151	60.000	0.00	0.00	35.62	4.00
156	193	0.174389	CGATGCAGCTACTCACTGGT	59.826	55.000	0.00	0.00	35.62	4.00
157	194	1.649664	GATGCAGCTACTCACTGGTG	58.350	55.000	0.00	0.00	35.62	4.17
158	195	1.205655	GATGCAGCTACTCACTGGTGA	59.794	52.381	0.00	3.34	35.62	4.02
159	196	1.047801	TGCAGCTACTCACTGGTGAA	58.952	50.000	4.94	0.00	39.39	3.18
164	201	1.555075	GCTACTCACTGGTGAATCCCA	59.445	52.381	4.94	0.00	39.39	4.37
182	219	4.481112	GCGTTGCAAGCCGGATGG	62.481	66.667	5.05	0.00	38.77	3.51
184	221	3.451894	GTTGCAAGCCGGATGGGG	61.452	66.667	5.05	0.00	35.78	4.96
205	242	3.372730	CCATGGTGCACGGGGTTG	61.373	66.667	11.45	3.64	0.00	3.77
218	256	3.737172	GGTTGTTGGCGCTGCGAT	61.737	61.111	28.07	0.00	0.00	4.58
229	267	1.359117	GCTGCGATGCAATGCTCAT	59.641	52.632	6.82	0.00	38.41	2.90
242	280	4.193334	CTCATCAGCGGCCGTCGA	62.193	66.667	28.70	23.17	42.43	4.20
243	281	4.492160	TCATCAGCGGCCGTCGAC	62.492	66.667	28.70	10.05	42.43	4.20
263	301	2.885113	TGCGATGCAGCTACTCGT	59.115	55.556	8.31	0.00	38.13	4.18
266	304	1.352056	CGATGCAGCTACTCGTCGA	59.648	57.895	15.22	0.00	42.46	4.20
273	311	2.462782	GCTACTCGTCGACGGCTCT	61.463	63.158	35.05	18.06	40.29	4.09
279	317	1.154016	CGTCGACGGCTCTTGATGT	60.154	57.895	29.70	0.00	35.37	3.06

Showing 1 to 25 of 228 entries

Previous1 2 3 4 5…10Next

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability
89	90	1.421485	CATCGCAAGCACCGAGTTC	59.579	57.895	0.00	0.00	38.20	3.01
91	92	3.121030	GCATCGCAAGCACCGAGT	61.121	61.111	0.00	0.00	38.20	4.18
93	94	3.120385	CTGCATCGCAAGCACCGA	61.120	61.111	0.00	0.00	38.41	4.69
122	158	4.812476	TCGCAAGCACGGGATCCG	62.812	66.667	5.45	4.67	46.26	4.18
124	160	3.017323	CATCGCAAGCACGGGATC	58.983	61.111	0.00	0.00	36.51	3.36
141	178	2.275318	GATTCACCAGTGAGTAGCTGC	58.725	52.381	0.00	0.00	41.13	5.25
142	179	2.419297	GGGATTCACCAGTGAGTAGCTG	60.419	54.545	0.00	0.00	41.13	4.24
153	190	1.971167	GCAACGCTGGGATTCACCA	60.971	57.895	0.00	0.00	41.20	4.17
155	192	0.109597	CTTGCAACGCTGGGATTCAC	60.110	55.000	0.00	0.00	0.00	3.18
156	193	1.865788	GCTTGCAACGCTGGGATTCA	61.866	55.000	11.98	0.00	0.00	2.57
157	194	1.153958	GCTTGCAACGCTGGGATTC	60.154	57.895	11.98	0.00	0.00	2.52
158	195	2.639327	GGCTTGCAACGCTGGGATT	61.639	57.895	16.77	0.00	0.00	3.01
159	196	3.064324	GGCTTGCAACGCTGGGAT	61.064	61.111	16.77	0.00	0.00	3.85
164	201	3.434319	CATCCGGCTTGCAACGCT	61.434	61.111	16.77	0.49	0.00	5.07
168	205	4.757355	CCCCCATCCGGCTTGCAA	62.757	66.667	0.00	0.00	0.00	4.08
202	239	2.502510	CATCGCAGCGCCAACAAC	60.503	61.111	10.87	0.00	0.00	3.32
205	242	3.688475	ATTGCATCGCAGCGCCAAC	62.688	57.895	10.87	0.00	40.61	3.77
211	249	0.660595	GATGAGCATTGCATCGCAGC	60.661	55.000	11.91	2.65	40.61	5.25
215	253	0.384353	CGCTGATGAGCATTGCATCG	60.384	55.000	11.91	4.42	46.62	3.84
218	256	2.767445	GCCGCTGATGAGCATTGCA	61.767	57.895	11.91	0.00	46.62	4.08
246	284	1.226688	GACGAGTAGCTGCATCGCA	60.227	57.895	18.23	0.00	40.02	5.10
247	285	2.289375	CGACGAGTAGCTGCATCGC	61.289	63.158	18.23	12.36	40.02	4.58
248	286	0.926174	GTCGACGAGTAGCTGCATCG	60.926	60.000	17.24	17.24	42.04	3.84
249	287	0.926174	CGTCGACGAGTAGCTGCATC	60.926	60.000	33.35	0.00	43.02	3.91
250	288	1.062685	CGTCGACGAGTAGCTGCAT	59.937	57.895	33.35	0.00	43.02	3.96

Showing 1 to 25 of 259 entries

Previous1 2 3 4 5…11Next

Based at the University of Bristol with support from BBSRC.

AutoCloner maintained by Alex Coulton.