Multiple sequence alignment - TraesCS4D01G030500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G030500 chr4D 100.000 6844 0 0 1 6844 13927296 13934139 0.000000e+00 12639.0
1 TraesCS4D01G030500 chr4D 98.458 6355 77 6 1 6347 13743063 13749404 0.000000e+00 11173.0
2 TraesCS4D01G030500 chr4D 99.614 4401 13 4 1 4399 13837821 13842219 0.000000e+00 8030.0
3 TraesCS4D01G030500 chr4D 91.304 391 18 4 5959 6347 13842296 13842672 2.830000e-143 520.0
4 TraesCS4D01G030500 chr4B 97.225 5766 84 25 600 6347 24397835 24403542 0.000000e+00 9692.0
5 TraesCS4D01G030500 chr4B 98.541 5276 48 6 1047 6319 24538466 24543715 0.000000e+00 9289.0
6 TraesCS4D01G030500 chr4B 98.079 989 13 3 1 983 24537478 24538466 0.000000e+00 1716.0
7 TraesCS4D01G030500 chr4A 97.474 5265 91 13 1008 6258 588615092 588620328 0.000000e+00 8948.0
8 TraesCS4D01G030500 chr4A 87.318 3091 270 53 999 4033 457235397 457238421 0.000000e+00 3424.0
9 TraesCS4D01G030500 chr4A 93.495 1937 78 19 4405 6322 574157216 574155309 0.000000e+00 2835.0
10 TraesCS4D01G030500 chr4A 93.240 1938 85 17 4402 6319 457237877 457239788 0.000000e+00 2811.0
11 TraesCS4D01G030500 chr4A 93.468 1776 71 17 4402 6158 586858590 586860339 0.000000e+00 2595.0
12 TraesCS4D01G030500 chr4A 93.345 1773 74 16 4405 6158 586919277 586917530 0.000000e+00 2580.0
13 TraesCS4D01G030500 chr4A 91.887 1060 57 14 1 1048 586852970 586854012 0.000000e+00 1454.0
14 TraesCS4D01G030500 chr4A 91.864 1057 56 15 1 1048 586891469 586892504 0.000000e+00 1448.0
15 TraesCS4D01G030500 chr4A 90.341 1025 76 15 1 1013 457234369 457235382 0.000000e+00 1323.0
16 TraesCS4D01G030500 chr4A 89.474 836 65 8 1004 1832 586854000 586854819 0.000000e+00 1035.0
17 TraesCS4D01G030500 chr4A 92.262 168 11 2 6152 6319 586860496 586860661 3.190000e-58 237.0
18 TraesCS4D01G030500 chr4A 90.643 171 14 2 6152 6322 586917373 586917205 6.910000e-55 226.0
19 TraesCS4D01G030500 chr3B 95.679 4837 136 23 2035 6835 454190563 454185764 0.000000e+00 7707.0
20 TraesCS4D01G030500 chr3B 98.160 3315 47 4 3006 6319 454486799 454483498 0.000000e+00 5771.0
21 TraesCS4D01G030500 chr3B 94.391 3441 133 31 432 3831 454374988 454371567 0.000000e+00 5230.0
22 TraesCS4D01G030500 chr3B 95.674 3028 78 18 3831 6835 454367385 454364388 0.000000e+00 4817.0
23 TraesCS4D01G030500 chr3B 92.681 3238 169 41 1 3186 453997911 453994690 0.000000e+00 4604.0
24 TraesCS4D01G030500 chr3B 97.143 2730 44 3 3038 5767 453994707 453992012 0.000000e+00 4578.0
25 TraesCS4D01G030500 chr3B 95.727 2153 45 19 795 2931 454488943 454486822 0.000000e+00 3422.0
26 TraesCS4D01G030500 chr3B 91.851 2074 116 31 1 2034 454204828 454202768 0.000000e+00 2844.0
27 TraesCS4D01G030500 chr3B 97.693 1127 15 6 1 1118 454376110 454374986 0.000000e+00 1927.0
28 TraesCS4D01G030500 chr3B 91.216 592 29 13 6263 6835 453992018 453991431 0.000000e+00 784.0
29 TraesCS4D01G030500 chrUn 99.822 1682 3 0 2513 4194 379573553 379575234 0.000000e+00 3090.0
30 TraesCS4D01G030500 chr2B 97.059 34 0 1 6484 6517 217265173 217265205 1.000000e-03 56.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G030500 chr4D 13927296 13934139 6843 False 12639.000000 12639 100.000000 1 6844 1 chr4D.!!$F2 6843
1 TraesCS4D01G030500 chr4D 13743063 13749404 6341 False 11173.000000 11173 98.458000 1 6347 1 chr4D.!!$F1 6346
2 TraesCS4D01G030500 chr4D 13837821 13842672 4851 False 4275.000000 8030 95.459000 1 6347 2 chr4D.!!$F3 6346
3 TraesCS4D01G030500 chr4B 24397835 24403542 5707 False 9692.000000 9692 97.225000 600 6347 1 chr4B.!!$F1 5747
4 TraesCS4D01G030500 chr4B 24537478 24543715 6237 False 5502.500000 9289 98.310000 1 6319 2 chr4B.!!$F2 6318
5 TraesCS4D01G030500 chr4A 588615092 588620328 5236 False 8948.000000 8948 97.474000 1008 6258 1 chr4A.!!$F2 5250
6 TraesCS4D01G030500 chr4A 574155309 574157216 1907 True 2835.000000 2835 93.495000 4405 6322 1 chr4A.!!$R1 1917
7 TraesCS4D01G030500 chr4A 457234369 457239788 5419 False 2519.333333 3424 90.299667 1 6319 3 chr4A.!!$F3 6318
8 TraesCS4D01G030500 chr4A 586891469 586892504 1035 False 1448.000000 1448 91.864000 1 1048 1 chr4A.!!$F1 1047
9 TraesCS4D01G030500 chr4A 586917205 586919277 2072 True 1403.000000 2580 91.994000 4405 6322 2 chr4A.!!$R2 1917
10 TraesCS4D01G030500 chr4A 586852970 586860661 7691 False 1330.250000 2595 91.772750 1 6319 4 chr4A.!!$F4 6318
11 TraesCS4D01G030500 chr3B 454185764 454190563 4799 True 7707.000000 7707 95.679000 2035 6835 1 chr3B.!!$R1 4800
12 TraesCS4D01G030500 chr3B 454364388 454367385 2997 True 4817.000000 4817 95.674000 3831 6835 1 chr3B.!!$R3 3004
13 TraesCS4D01G030500 chr3B 454483498 454488943 5445 True 4596.500000 5771 96.943500 795 6319 2 chr3B.!!$R6 5524
14 TraesCS4D01G030500 chr3B 454371567 454376110 4543 True 3578.500000 5230 96.042000 1 3831 2 chr3B.!!$R5 3830
15 TraesCS4D01G030500 chr3B 453991431 453997911 6480 True 3322.000000 4604 93.680000 1 6835 3 chr3B.!!$R4 6834
16 TraesCS4D01G030500 chr3B 454202768 454204828 2060 True 2844.000000 2844 91.851000 1 2034 1 chr3B.!!$R2 2033
17 TraesCS4D01G030500 chrUn 379573553 379575234 1681 False 3090.000000 3090 99.822000 2513 4194 1 chrUn.!!$F1 1681

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
800 1514 6.475402 GGAATTTACGAAATCCGCATTTTCAT 59.525 34.615 0.0 0.0 43.32 2.57 F
2017 4733 1.374252 CACTACCTTCGCCGCTGTT 60.374 57.895 0.0 0.0 0.00 3.16 F
4768 9698 4.060900 CTCTACGTGGCTTGCAATATCAT 58.939 43.478 0.0 0.0 0.00 2.45 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2207 5174 0.474660 AGTCCTCCTCCCAGTTGCTT 60.475 55.000 0.0 0.0 0.00 3.91 R
3651 6767 8.100508 AGTTACAGATAGAAAGAAAGGTTTGC 57.899 34.615 0.0 0.0 0.00 3.68 R
6326 11449 1.368641 TGAATGGCTTCGAATGTCCG 58.631 50.000 0.0 0.0 33.86 4.79 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
800 1514 6.475402 GGAATTTACGAAATCCGCATTTTCAT 59.525 34.615 0.00 0.00 43.32 2.57
2017 4733 1.374252 CACTACCTTCGCCGCTGTT 60.374 57.895 0.00 0.00 0.00 3.16
4768 9698 4.060900 CTCTACGTGGCTTGCAATATCAT 58.939 43.478 0.00 0.00 0.00 2.45
5041 9971 2.435422 CATGCATGTACAGGACAACCA 58.565 47.619 18.91 0.00 42.78 3.67
5659 10591 3.582208 ACTCCTTTGATGAAGAGCAGAGT 59.418 43.478 0.00 0.00 37.57 3.24
6254 11377 1.055338 GTTCGTCCGGTAGTGAAACG 58.945 55.000 0.00 1.59 45.86 3.60
6297 11420 7.141758 TCTAATAGTCAGGGCATCTTCAAAT 57.858 36.000 0.00 0.00 0.00 2.32
6300 11423 4.038271 AGTCAGGGCATCTTCAAATTCA 57.962 40.909 0.00 0.00 0.00 2.57
6326 11449 5.587844 ACTCTCAAATCACTTGCATATGTCC 59.412 40.000 4.29 0.00 34.76 4.02
6447 11576 8.477256 TCAAAATCAGTGAACCTTTTTCAGAAT 58.523 29.630 0.00 0.00 0.00 2.40
6759 11920 2.865551 GACCAGACAACCGTAAAACGAA 59.134 45.455 0.15 0.00 46.05 3.85
6796 11957 1.005394 CCGCCCAACTCGTGTAACT 60.005 57.895 0.00 0.00 31.75 2.24
6821 11982 2.336088 CCCAAACCAAGCTGCGTG 59.664 61.111 8.66 8.66 0.00 5.34
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
2207 5174 0.474660 AGTCCTCCTCCCAGTTGCTT 60.475 55.000 0.00 0.00 0.00 3.91
3651 6767 8.100508 AGTTACAGATAGAAAGAAAGGTTTGC 57.899 34.615 0.00 0.00 0.00 3.68
4324 7440 4.996758 TCTCTCATTTGCATCTTTTCGTCA 59.003 37.500 0.00 0.00 0.00 4.35
5041 9971 0.106335 AGAGAAGCTAGCGCATGCAT 59.894 50.000 19.57 13.62 46.23 3.96
6254 11377 4.035278 AGAGCAAGATACGAGCAGTAAC 57.965 45.455 0.00 0.00 39.04 2.50
6297 11420 4.707105 TGCAAGTGATTTGAGAGTCTGAA 58.293 39.130 0.00 0.00 39.21 3.02
6300 11423 6.413052 ACATATGCAAGTGATTTGAGAGTCT 58.587 36.000 1.58 0.00 39.21 3.24
6326 11449 1.368641 TGAATGGCTTCGAATGTCCG 58.631 50.000 0.00 0.00 33.86 4.79
6727 11888 3.270877 GTTGTCTGGTCAACTGTTCACT 58.729 45.455 0.00 0.00 42.76 3.41
6787 11948 2.652530 GCCGACCCAGTTACACGA 59.347 61.111 0.00 0.00 0.00 4.35


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.