Multiple sequence alignment - TraesCS4D01G024700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G024700 chr4D 100.000 2807 0 0 1 2807 10810456 10813262 0.000000e+00 5184.0
1 TraesCS4D01G024700 chr4D 98.039 2601 47 3 208 2807 10828432 10831029 0.000000e+00 4518.0
2 TraesCS4D01G024700 chr4D 92.717 357 24 2 2059 2414 10881872 10881517 5.360000e-142 514.0
3 TraesCS4D01G024700 chr4D 91.406 256 13 5 2555 2807 10881502 10881253 2.680000e-90 342.0
4 TraesCS4D01G024700 chr4A 91.221 1572 115 11 365 1931 591674292 591675845 0.000000e+00 2117.0
5 TraesCS4D01G024700 chr4A 91.100 1573 117 11 364 1931 591346787 591348341 0.000000e+00 2108.0
6 TraesCS4D01G024700 chr4A 91.100 1573 117 11 364 1931 592927989 592926435 0.000000e+00 2108.0
7 TraesCS4D01G024700 chr4A 90.909 1573 118 12 364 1931 591416306 591417858 0.000000e+00 2089.0
8 TraesCS4D01G024700 chr4A 90.782 1573 120 13 364 1931 591293021 591294573 0.000000e+00 2078.0
9 TraesCS4D01G024700 chr4A 90.597 1574 122 15 364 1931 592336335 592334782 0.000000e+00 2063.0
10 TraesCS4D01G024700 chr4A 90.337 1573 130 12 364 1931 592362657 592361102 0.000000e+00 2043.0
11 TraesCS4D01G024700 chr4A 90.879 1524 115 12 364 1882 592310378 592308874 0.000000e+00 2023.0
12 TraesCS4D01G024700 chr4A 89.024 164 17 1 2056 2218 591694066 591693903 4.740000e-48 202.0
13 TraesCS4D01G024700 chr4A 93.233 133 8 1 233 365 32715469 32715338 7.930000e-46 195.0
14 TraesCS4D01G024700 chr4A 89.630 135 12 2 233 365 591292860 591292994 1.340000e-38 171.0
15 TraesCS4D01G024700 chr4A 89.630 135 12 2 233 365 591346626 591346760 1.340000e-38 171.0
16 TraesCS4D01G024700 chr4A 89.630 135 12 2 233 365 591416145 591416279 1.340000e-38 171.0
17 TraesCS4D01G024700 chr4B 96.433 757 23 3 2054 2807 20356031 20356786 0.000000e+00 1245.0
18 TraesCS4D01G024700 chr4B 95.902 366 10 3 1 365 20354085 20354446 3.110000e-164 588.0
19 TraesCS4D01G024700 chr4B 90.256 390 34 3 2028 2414 20370419 20370031 8.970000e-140 507.0
20 TraesCS4D01G024700 chr4B 90.234 256 16 5 2555 2807 20370016 20369767 2.700000e-85 326.0
21 TraesCS4D01G024700 chrUn 82.486 354 36 18 233 563 256114289 256114639 1.270000e-73 287.0
22 TraesCS4D01G024700 chr5B 82.353 357 37 18 233 566 660880717 660880364 1.270000e-73 287.0
23 TraesCS4D01G024700 chr5B 82.353 357 37 18 233 566 660926666 660926313 1.270000e-73 287.0
24 TraesCS4D01G024700 chr7D 95.763 118 5 0 1938 2055 545698742 545698859 1.030000e-44 191.0
25 TraesCS4D01G024700 chr6B 97.321 112 3 0 1947 2058 460495301 460495412 1.030000e-44 191.0
26 TraesCS4D01G024700 chr6B 90.909 110 10 0 2450 2559 421417693 421417584 6.260000e-32 148.0
27 TraesCS4D01G024700 chr6B 87.597 129 14 2 2431 2559 469343979 469344105 6.260000e-32 148.0
28 TraesCS4D01G024700 chr2D 98.165 109 2 0 1948 2056 617397857 617397749 1.030000e-44 191.0
29 TraesCS4D01G024700 chr2D 94.215 121 6 1 1937 2056 529636374 529636494 1.720000e-42 183.0
30 TraesCS4D01G024700 chr2A 97.321 112 3 0 1945 2056 758757136 758757247 1.030000e-44 191.0
31 TraesCS4D01G024700 chr2B 97.297 111 3 0 1946 2056 501608021 501608131 3.690000e-44 189.0
32 TraesCS4D01G024700 chr2B 90.756 119 9 2 2441 2559 621062643 621062527 1.040000e-34 158.0
33 TraesCS4D01G024700 chr1B 97.297 111 3 0 1946 2056 476016021 476016131 3.690000e-44 189.0
34 TraesCS4D01G024700 chr1B 96.396 111 4 0 1944 2054 61942032 61941922 1.720000e-42 183.0
35 TraesCS4D01G024700 chr1B 84.397 141 13 5 90 228 118428860 118428993 2.270000e-26 130.0
36 TraesCS4D01G024700 chr1A 91.379 116 9 1 2447 2562 384334444 384334558 1.040000e-34 158.0
37 TraesCS4D01G024700 chr7A 89.431 123 13 0 2450 2572 729073329 729073207 3.740000e-34 156.0
38 TraesCS4D01G024700 chr7B 88.372 129 13 2 2431 2559 528214892 528215018 1.350000e-33 154.0
39 TraesCS4D01G024700 chr6A 90.083 121 9 2 2452 2571 26954888 26954770 1.350000e-33 154.0
40 TraesCS4D01G024700 chr5A 85.039 127 12 5 103 228 398787113 398786993 3.800000e-24 122.0
41 TraesCS4D01G024700 chr3B 90.476 63 6 0 2592 2654 580469792 580469730 1.790000e-12 84.2


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G024700 chr4D 10810456 10813262 2806 False 5184.0 5184 100.0000 1 2807 1 chr4D.!!$F1 2806
1 TraesCS4D01G024700 chr4D 10828432 10831029 2597 False 4518.0 4518 98.0390 208 2807 1 chr4D.!!$F2 2599
2 TraesCS4D01G024700 chr4D 10881253 10881872 619 True 428.0 514 92.0615 2059 2807 2 chr4D.!!$R1 748
3 TraesCS4D01G024700 chr4A 591674292 591675845 1553 False 2117.0 2117 91.2210 365 1931 1 chr4A.!!$F1 1566
4 TraesCS4D01G024700 chr4A 592926435 592927989 1554 True 2108.0 2108 91.1000 364 1931 1 chr4A.!!$R6 1567
5 TraesCS4D01G024700 chr4A 592334782 592336335 1553 True 2063.0 2063 90.5970 364 1931 1 chr4A.!!$R4 1567
6 TraesCS4D01G024700 chr4A 592361102 592362657 1555 True 2043.0 2043 90.3370 364 1931 1 chr4A.!!$R5 1567
7 TraesCS4D01G024700 chr4A 592308874 592310378 1504 True 2023.0 2023 90.8790 364 1882 1 chr4A.!!$R3 1518
8 TraesCS4D01G024700 chr4A 591346626 591348341 1715 False 1139.5 2108 90.3650 233 1931 2 chr4A.!!$F3 1698
9 TraesCS4D01G024700 chr4A 591416145 591417858 1713 False 1130.0 2089 90.2695 233 1931 2 chr4A.!!$F4 1698
10 TraesCS4D01G024700 chr4A 591292860 591294573 1713 False 1124.5 2078 90.2060 233 1931 2 chr4A.!!$F2 1698
11 TraesCS4D01G024700 chr4B 20354085 20356786 2701 False 916.5 1245 96.1675 1 2807 2 chr4B.!!$F1 2806
12 TraesCS4D01G024700 chr4B 20369767 20370419 652 True 416.5 507 90.2450 2028 2807 2 chr4B.!!$R1 779

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
146 147 1.017701 CGACCGGAAAGCAGGTAACC 61.018 60.0 9.46 0.0 42.94 2.85 F
740 779 1.365699 CCATCCCACGAGGTTAAACG 58.634 55.0 0.00 0.0 36.75 3.60 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1805 1854 1.871080 GCAGTATATGCGGTGAGCTT 58.129 50.0 0.00 0.0 46.99 3.74 R
1941 1992 2.692041 CCGAACGGAGGGAGTACTTAAT 59.308 50.0 7.53 0.0 37.50 1.40 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
99 100 1.546834 GAGGACTTACTAGTTGCGCG 58.453 55.000 0.00 0.00 33.84 6.86
116 117 3.188786 GCGAGCGTTCCGAGCATT 61.189 61.111 0.00 0.00 37.01 3.56
146 147 1.017701 CGACCGGAAAGCAGGTAACC 61.018 60.000 9.46 0.00 42.94 2.85
403 435 6.183360 CGCAAGAATTTTAAATGCCAAGTACC 60.183 38.462 5.40 0.00 43.02 3.34
466 498 1.603455 CCCTTCACGTGGCCACAAT 60.603 57.895 34.16 19.81 0.00 2.71
495 527 5.360714 TGTTTTGTCTTTCATCCTTCAAGCT 59.639 36.000 0.00 0.00 0.00 3.74
740 779 1.365699 CCATCCCACGAGGTTAAACG 58.634 55.000 0.00 0.00 36.75 3.60
785 824 5.124776 TGCTACTATTATTGGTTTGTGGCAC 59.875 40.000 11.55 11.55 37.09 5.01
870 910 2.335316 AATTTGGGCGCGGTAATCTA 57.665 45.000 8.83 0.00 0.00 1.98
1374 1423 1.482593 CCAGAGGCCAAGTACGAATCT 59.517 52.381 5.01 0.00 0.00 2.40
1805 1854 0.248289 GCCGGTGGCTACAAAGTCTA 59.752 55.000 1.90 0.00 46.69 2.59
1941 1992 1.001706 CGGCGATCGATGACCTCTTAA 60.002 52.381 21.57 0.00 42.43 1.85
2512 2566 5.273674 TCAAACCATCTGCAAAACAATCA 57.726 34.783 0.00 0.00 0.00 2.57
2524 2578 6.256686 TGCAAAACAATCAATTTTGAGTTGC 58.743 32.000 18.20 18.20 45.75 4.17
2672 2726 4.740902 AGCCATAACCCTTGTTTTCTTCT 58.259 39.130 0.00 0.00 35.87 2.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
129 130 1.377612 GGGTTACCTGCTTTCCGGT 59.622 57.895 0.00 0.00 37.31 5.28
211 213 5.258051 TGATTTTAGGTGCGTCCCTTAATT 58.742 37.500 0.22 0.00 35.97 1.40
403 435 8.147058 AGATTGTAGCAGATCATAGTTAAGGTG 58.853 37.037 0.00 0.00 0.00 4.00
466 498 8.634335 TGAAGGATGAAAGACAAAACATGATA 57.366 30.769 0.00 0.00 0.00 2.15
495 527 8.051468 TGTACCAATCCTCCAAATATATCCAA 57.949 34.615 0.00 0.00 0.00 3.53
740 779 6.159988 AGCATTGATTAGATCGCTAACTACC 58.840 40.000 0.00 0.00 39.29 3.18
785 824 2.074547 TTAAACCCGTGAGCTCTTCG 57.925 50.000 16.19 18.17 0.00 3.79
870 910 1.599047 CACGTTGAGAGGCCAGGAT 59.401 57.895 5.01 0.00 0.00 3.24
1374 1423 3.661911 CCGAACATGGCCACGAAA 58.338 55.556 8.16 0.00 0.00 3.46
1805 1854 1.871080 GCAGTATATGCGGTGAGCTT 58.129 50.000 0.00 0.00 46.99 3.74
1941 1992 2.692041 CCGAACGGAGGGAGTACTTAAT 59.308 50.000 7.53 0.00 37.50 1.40
2493 2547 7.282675 TCAAAATTGATTGTTTTGCAGATGGTT 59.717 29.630 6.49 0.00 43.04 3.67
2524 2578 5.728351 TCACTTTTGTAAGTCGTTTCAGG 57.272 39.130 0.00 0.00 42.67 3.86
2595 2649 7.457380 TTGGAGGATTGAAATCTCTAGGATT 57.543 36.000 3.21 0.00 45.61 3.01
2748 2803 5.012046 GGGTTGGAGTGGATGAAAATTTTCT 59.988 40.000 26.73 15.09 38.02 2.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.