Multiple sequence alignment - TraesCS4D01G011100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G011100 chr4D 100.000 2372 0 0 1 2372 5519148 5516777 0.000000e+00 4381.0
1 TraesCS4D01G011100 chr4D 92.140 916 58 10 1462 2372 2641827 2642733 0.000000e+00 1280.0
2 TraesCS4D01G011100 chr4A 89.911 1913 158 18 388 2282 598156079 598157974 0.000000e+00 2431.0
3 TraesCS4D01G011100 chr4A 90.455 1142 93 8 14 1151 598118251 598117122 0.000000e+00 1491.0
4 TraesCS4D01G011100 chr4A 92.645 911 61 2 1463 2372 596420307 596421212 0.000000e+00 1306.0
5 TraesCS4D01G011100 chr4A 92.316 911 64 2 1463 2372 596379369 596380274 0.000000e+00 1290.0
6 TraesCS4D01G011100 chr4A 92.825 892 58 2 1482 2372 596383292 596384178 0.000000e+00 1288.0
7 TraesCS4D01G011100 chr4A 92.650 898 59 3 1476 2372 596430285 596431176 0.000000e+00 1286.0
8 TraesCS4D01G011100 chr4A 96.440 618 21 1 4 620 598155460 598156077 0.000000e+00 1018.0
9 TraesCS4D01G011100 chr4A 94.904 314 16 0 1153 1466 598117020 598116707 2.120000e-135 492.0
10 TraesCS4D01G011100 chr3D 97.672 1074 25 0 1299 2372 287281 286208 0.000000e+00 1845.0
11 TraesCS4D01G011100 chr3D 92.105 912 65 3 1463 2372 3707310 3706404 0.000000e+00 1279.0
12 TraesCS4D01G011100 chr3D 92.105 912 64 4 1463 2372 3712797 3711892 0.000000e+00 1279.0
13 TraesCS4D01G011100 chr4B 89.037 1204 104 18 38 1215 9521801 9523002 0.000000e+00 1467.0
14 TraesCS4D01G011100 chr4B 94.141 256 15 0 1211 1466 9528336 9528591 7.950000e-105 390.0
15 TraesCS4D01G011100 chrUn 92.140 916 58 10 1462 2372 370925162 370924256 0.000000e+00 1280.0
16 TraesCS4D01G011100 chr1D 76.033 242 51 6 105 343 356210257 356210020 4.140000e-23 119.0
17 TraesCS4D01G011100 chr1D 100.000 31 0 0 471 501 5799215 5799185 9.160000e-05 58.4
18 TraesCS4D01G011100 chr6D 100.000 31 0 0 471 501 1842262 1842232 9.160000e-05 58.4
19 TraesCS4D01G011100 chr6D 100.000 31 0 0 471 501 20488044 20488014 9.160000e-05 58.4
20 TraesCS4D01G011100 chr6D 97.059 34 1 0 468 501 375170053 375170086 9.160000e-05 58.4
21 TraesCS4D01G011100 chr5B 94.737 38 1 1 464 501 681842516 681842480 9.160000e-05 58.4


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G011100 chr4D 5516777 5519148 2371 True 4381.0 4381 100.0000 1 2372 1 chr4D.!!$R1 2371
1 TraesCS4D01G011100 chr4D 2641827 2642733 906 False 1280.0 1280 92.1400 1462 2372 1 chr4D.!!$F1 910
2 TraesCS4D01G011100 chr4A 598155460 598157974 2514 False 1724.5 2431 93.1755 4 2282 2 chr4A.!!$F4 2278
3 TraesCS4D01G011100 chr4A 596420307 596421212 905 False 1306.0 1306 92.6450 1463 2372 1 chr4A.!!$F1 909
4 TraesCS4D01G011100 chr4A 596379369 596384178 4809 False 1289.0 1290 92.5705 1463 2372 2 chr4A.!!$F3 909
5 TraesCS4D01G011100 chr4A 596430285 596431176 891 False 1286.0 1286 92.6500 1476 2372 1 chr4A.!!$F2 896
6 TraesCS4D01G011100 chr4A 598116707 598118251 1544 True 991.5 1491 92.6795 14 1466 2 chr4A.!!$R1 1452
7 TraesCS4D01G011100 chr3D 286208 287281 1073 True 1845.0 1845 97.6720 1299 2372 1 chr3D.!!$R1 1073
8 TraesCS4D01G011100 chr3D 3706404 3707310 906 True 1279.0 1279 92.1050 1463 2372 1 chr3D.!!$R2 909
9 TraesCS4D01G011100 chr3D 3711892 3712797 905 True 1279.0 1279 92.1050 1463 2372 1 chr3D.!!$R3 909
10 TraesCS4D01G011100 chr4B 9521801 9523002 1201 False 1467.0 1467 89.0370 38 1215 1 chr4B.!!$F1 1177
11 TraesCS4D01G011100 chrUn 370924256 370925162 906 True 1280.0 1280 92.1400 1462 2372 1 chrUn.!!$R1 910

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
655 899 2.57941 TTTTCCCTAGGGCACACTTC 57.421 50.0 24.42 0.0 34.68 3.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2195 6675 1.003839 GTCGGGTCATCTTGGTGCA 60.004 57.895 0.0 0.0 0.0 4.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
160 168 3.262135 GAGAATCTCTCCATCGTCGTC 57.738 52.381 2.45 0.00 37.55 4.20
309 317 6.214615 TGAAGGTAAACACCATTCTCCTGATA 59.785 38.462 0.00 0.00 0.00 2.15
351 359 7.015289 CGTTAACACTTGACATGATTTACTGG 58.985 38.462 6.39 0.00 0.00 4.00
374 382 8.362464 TGGTAACTAAGTGACTATGTGATCTT 57.638 34.615 0.00 0.00 37.61 2.40
499 509 6.153851 TCAGGAAAACAAGATCATCATGCAAT 59.846 34.615 0.00 0.00 0.00 3.56
655 899 2.579410 TTTTCCCTAGGGCACACTTC 57.421 50.000 24.42 0.00 34.68 3.01
695 939 5.794945 CGACGAACGTAATAAACTACCTCAA 59.205 40.000 0.00 0.00 37.22 3.02
708 952 7.710766 AAACTACCTCAAAAAGACTTCGTAG 57.289 36.000 0.00 0.00 0.00 3.51
783 1027 5.517411 GCATTAATTAACCAAGCCGTAAACC 59.483 40.000 0.00 0.00 0.00 3.27
1058 1323 1.213013 CTCTCGTGGTTCTGTCCCG 59.787 63.158 0.00 0.00 0.00 5.14
1118 1385 9.394767 TCTAATTGTTGTATGTCTATGCATGTT 57.605 29.630 10.16 0.00 0.00 2.71
1474 1843 7.320560 GTCACTGCTTATCTAAAACAAAACGAC 59.679 37.037 0.00 0.00 0.00 4.34
1480 1849 7.903431 GCTTATCTAAAACAAAACGACGATCAT 59.097 33.333 0.00 0.00 0.00 2.45
1579 3885 3.728076 TCAGTACTGAAAACAGCTCGT 57.272 42.857 23.24 0.00 36.53 4.18
1799 6277 2.614481 GCACCAAGATGACCCGACTTTA 60.614 50.000 0.00 0.00 0.00 1.85
1919 6397 3.890147 ACCCGACTCACTTCTATATCACC 59.110 47.826 0.00 0.00 0.00 4.02
2010 6488 7.611467 TCAAAAATAGCATGACTAACACCTGAT 59.389 33.333 0.00 0.00 33.57 2.90
2180 6660 7.924412 TCCACGTTAATATTCCAGTACTGATTC 59.076 37.037 24.68 4.44 0.00 2.52
2195 6675 7.068839 CAGTACTGATTCCCATACTGAACTAGT 59.931 40.741 18.45 0.00 44.81 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
16 17 5.420739 TGCAGTTGGTCTCATACACACTATA 59.579 40.000 0.00 0.00 0.00 1.31
26 27 0.322277 CAGCCTGCAGTTGGTCTCAT 60.322 55.000 13.81 0.00 0.00 2.90
159 167 6.489022 TGATTCGATACTAGAATTTCCTCCGA 59.511 38.462 0.00 0.00 38.32 4.55
160 168 6.678878 TGATTCGATACTAGAATTTCCTCCG 58.321 40.000 0.00 0.00 38.32 4.63
378 386 5.948162 TGGATAGACCTAACCCGTGATATAC 59.052 44.000 1.61 0.00 39.86 1.47
499 509 8.083462 TGAAACATACACACGAAGTAGTTCATA 58.917 33.333 10.83 0.00 41.61 2.15
641 885 0.400213 TGTTGGAAGTGTGCCCTAGG 59.600 55.000 0.06 0.06 0.00 3.02
655 899 1.198178 CGTCGGGTGGTAAATTGTTGG 59.802 52.381 0.00 0.00 0.00 3.77
704 948 7.878477 TTACCGCTCCATAAATTAATCTACG 57.122 36.000 0.00 0.00 0.00 3.51
708 952 7.807907 CCATGTTTACCGCTCCATAAATTAATC 59.192 37.037 0.00 0.00 0.00 1.75
783 1027 7.227512 CCAGACCTTTTTGATATAGCTTACCAG 59.772 40.741 0.00 0.00 0.00 4.00
1431 1800 0.458025 GACGGCCAGTCGAAACTAGG 60.458 60.000 2.24 0.00 40.43 3.02
1474 1843 9.497030 GTGATATACAGCTAAGTCTTATGATCG 57.503 37.037 1.09 0.00 0.00 3.69
1525 3265 9.066892 ACAACAATATTAACATGGATAATCGCT 57.933 29.630 8.72 0.00 0.00 4.93
1579 3885 2.959516 AGAATTGAGTCATGCGTTCGA 58.040 42.857 0.00 0.00 0.00 3.71
2180 6660 2.236146 TGGTGCACTAGTTCAGTATGGG 59.764 50.000 17.98 0.00 34.98 4.00
2195 6675 1.003839 GTCGGGTCATCTTGGTGCA 60.004 57.895 0.00 0.00 0.00 4.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.