Multiple sequence alignment - TraesCS4B01G395300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G395300 chr4B 100.000 2597 0 0 1 2597 669558303 669560899 0.000000e+00 4796
1 TraesCS4B01G395300 chr4B 94.275 2620 88 27 1 2597 669471670 669474250 0.000000e+00 3951
2 TraesCS4B01G395300 chr4B 93.865 2608 96 27 1 2597 668513005 668515559 0.000000e+00 3871
3 TraesCS4B01G395300 chr4B 95.931 1794 61 6 1 1790 669342473 669340688 0.000000e+00 2898
4 TraesCS4B01G395300 chr4B 96.041 1667 59 4 1 1664 668649623 668651285 0.000000e+00 2706
5 TraesCS4B01G395300 chr4B 93.809 1793 88 12 1 1790 668972942 668974714 0.000000e+00 2675
6 TraesCS4B01G395300 chr4B 92.933 1797 81 19 1 1790 668587649 668589406 0.000000e+00 2573
7 TraesCS4B01G395300 chr4B 88.846 1542 93 35 254 1790 668445961 668447428 0.000000e+00 1821
8 TraesCS4B01G395300 chr4B 89.663 1335 47 19 558 1847 668402963 668404251 0.000000e+00 1616
9 TraesCS4B01G395300 chr4B 91.876 837 37 9 921 1733 666728693 666727864 0.000000e+00 1140
10 TraesCS4B01G395300 chr4B 92.773 761 35 7 1849 2597 668365371 668366123 0.000000e+00 1083
11 TraesCS4B01G395300 chr4B 92.470 757 27 17 1870 2597 668447558 668448313 0.000000e+00 1055
12 TraesCS4B01G395300 chr4B 91.938 769 32 17 1858 2597 669160673 669159906 0.000000e+00 1050
13 TraesCS4B01G395300 chr4B 91.927 768 32 16 1858 2597 669340560 669339795 0.000000e+00 1048
14 TraesCS4B01G395300 chr4B 90.561 784 35 20 1849 2597 668217626 668218405 0.000000e+00 1002
15 TraesCS4B01G395300 chr4B 87.949 863 81 14 930 1790 669161642 669160801 0.000000e+00 996
16 TraesCS4B01G395300 chr4B 82.690 907 83 33 961 1842 673413293 673412436 0.000000e+00 737
17 TraesCS4B01G395300 chr4B 88.811 572 33 17 2055 2597 668596199 668596768 0.000000e+00 673
18 TraesCS4B01G395300 chr4B 88.953 516 32 13 2104 2597 668451620 668452132 4.750000e-172 614
19 TraesCS4B01G395300 chr4B 95.513 312 14 0 1849 2160 668974833 668975144 1.390000e-137 499
20 TraesCS4B01G395300 chr4B 91.126 293 17 7 1861 2152 599587607 599587323 3.130000e-104 388
21 TraesCS4B01G395300 chr4B 87.983 233 10 6 2383 2597 668975388 668975620 2.560000e-65 259
22 TraesCS4B01G395300 chr5A 88.898 2450 128 57 1 2380 707848325 707850700 0.000000e+00 2885
23 TraesCS4B01G395300 chr5A 95.486 288 12 1 2311 2597 707850702 707850989 2.360000e-125 459
24 TraesCS4B01G395300 chrUn 100.000 746 0 0 1 746 346448733 346449478 0.000000e+00 1378
25 TraesCS4B01G395300 chrUn 100.000 746 0 0 1 746 348077199 348076454 0.000000e+00 1378
26 TraesCS4B01G395300 chrUn 84.426 1342 107 51 543 1847 79803866 79805142 0.000000e+00 1227
27 TraesCS4B01G395300 chrUn 86.872 975 68 19 909 1834 29364873 29363910 0.000000e+00 1037


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G395300 chr4B 669558303 669560899 2596 False 4796.000000 4796 100.000000 1 2597 1 chr4B.!!$F9 2596
1 TraesCS4B01G395300 chr4B 669471670 669474250 2580 False 3951.000000 3951 94.275000 1 2597 1 chr4B.!!$F8 2596
2 TraesCS4B01G395300 chr4B 668513005 668515559 2554 False 3871.000000 3871 93.865000 1 2597 1 chr4B.!!$F4 2596
3 TraesCS4B01G395300 chr4B 668649623 668651285 1662 False 2706.000000 2706 96.041000 1 1664 1 chr4B.!!$F7 1663
4 TraesCS4B01G395300 chr4B 668587649 668589406 1757 False 2573.000000 2573 92.933000 1 1790 1 chr4B.!!$F5 1789
5 TraesCS4B01G395300 chr4B 669339795 669342473 2678 True 1973.000000 2898 93.929000 1 2597 2 chr4B.!!$R5 2596
6 TraesCS4B01G395300 chr4B 668402963 668404251 1288 False 1616.000000 1616 89.663000 558 1847 1 chr4B.!!$F3 1289
7 TraesCS4B01G395300 chr4B 668445961 668452132 6171 False 1163.333333 1821 90.089667 254 2597 3 chr4B.!!$F10 2343
8 TraesCS4B01G395300 chr4B 668972942 668975620 2678 False 1144.333333 2675 92.435000 1 2597 3 chr4B.!!$F11 2596
9 TraesCS4B01G395300 chr4B 666727864 666728693 829 True 1140.000000 1140 91.876000 921 1733 1 chr4B.!!$R2 812
10 TraesCS4B01G395300 chr4B 668365371 668366123 752 False 1083.000000 1083 92.773000 1849 2597 1 chr4B.!!$F2 748
11 TraesCS4B01G395300 chr4B 669159906 669161642 1736 True 1023.000000 1050 89.943500 930 2597 2 chr4B.!!$R4 1667
12 TraesCS4B01G395300 chr4B 668217626 668218405 779 False 1002.000000 1002 90.561000 1849 2597 1 chr4B.!!$F1 748
13 TraesCS4B01G395300 chr4B 673412436 673413293 857 True 737.000000 737 82.690000 961 1842 1 chr4B.!!$R3 881
14 TraesCS4B01G395300 chr4B 668596199 668596768 569 False 673.000000 673 88.811000 2055 2597 1 chr4B.!!$F6 542
15 TraesCS4B01G395300 chr5A 707848325 707850989 2664 False 1672.000000 2885 92.192000 1 2597 2 chr5A.!!$F1 2596
16 TraesCS4B01G395300 chrUn 346448733 346449478 745 False 1378.000000 1378 100.000000 1 746 1 chrUn.!!$F2 745
17 TraesCS4B01G395300 chrUn 348076454 348077199 745 True 1378.000000 1378 100.000000 1 746 1 chrUn.!!$R2 745
18 TraesCS4B01G395300 chrUn 79803866 79805142 1276 False 1227.000000 1227 84.426000 543 1847 1 chrUn.!!$F1 1304
19 TraesCS4B01G395300 chrUn 29363910 29364873 963 True 1037.000000 1037 86.872000 909 1834 1 chrUn.!!$R1 925

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
997 1046 1.442688 CTTCTTCGCCGCCAAAAGC 60.443 57.895 0.0 0.0 38.52 3.51 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1952 2187 1.83363 GATGGACACTCACAGATCCCA 59.166 52.381 0.0 0.0 0.0 4.37 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
997 1046 1.442688 CTTCTTCGCCGCCAAAAGC 60.443 57.895 0.00 0.00 38.52 3.51
1002 1051 0.943359 TTCGCCGCCAAAAGCAAATG 60.943 50.000 0.00 0.00 44.04 2.32
1003 1052 1.372748 CGCCGCCAAAAGCAAATGA 60.373 52.632 0.00 0.00 44.04 2.57
1004 1053 1.616872 CGCCGCCAAAAGCAAATGAC 61.617 55.000 0.00 0.00 44.04 3.06
1077 1126 2.202987 GATGAGCTGGGCCACTCG 60.203 66.667 22.52 8.81 35.61 4.18
1317 1366 0.621862 CCCTGGAAGCCCTCCTACTT 60.622 60.000 0.00 0.00 45.64 2.24
1337 1386 4.999950 ACTTATGAAGAACTCAGCTGTTGG 59.000 41.667 14.67 7.99 37.52 3.77
1414 1475 4.079558 AGGATTATGTGGTCTCAGCCAAAT 60.080 41.667 0.00 0.00 40.68 2.32
1733 1859 3.558033 TCTTTGGTGGGTAGTGTTTTCC 58.442 45.455 0.00 0.00 0.00 3.13
1972 2212 1.833630 TGGGATCTGTGAGTGTCCATC 59.166 52.381 0.00 0.00 32.31 3.51
2172 2427 8.840200 ATAATCTCTACTCCTAAAGTTGGTCA 57.160 34.615 0.00 0.00 39.55 4.02
2254 2519 2.281208 CCTGGGCCGTCGAACAAA 60.281 61.111 0.00 0.00 0.00 2.83
2255 2520 1.894756 CCTGGGCCGTCGAACAAAA 60.895 57.895 0.00 0.00 0.00 2.44
2309 2575 3.182996 AAGGGGCCAAACCTCCGT 61.183 61.111 4.39 0.00 41.62 4.69
2499 2858 0.674581 CCTCTCACATCAAAGCCGCA 60.675 55.000 0.00 0.00 0.00 5.69
2569 2928 4.681978 GTTCACAGCCTCCGCCGT 62.682 66.667 0.00 0.00 34.57 5.68
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
997 1046 4.840401 TTTCGTAGAGCATCGTCATTTG 57.160 40.909 0.00 0.00 42.67 2.32
1002 1051 2.789893 GTGGATTTCGTAGAGCATCGTC 59.210 50.000 0.00 0.00 42.67 4.20
1003 1052 2.427453 AGTGGATTTCGTAGAGCATCGT 59.573 45.455 0.00 0.00 42.67 3.73
1004 1053 3.046390 GAGTGGATTTCGTAGAGCATCG 58.954 50.000 0.00 0.00 42.67 3.84
1057 1106 4.864334 GTGGCCCAGCTCATCGGG 62.864 72.222 0.00 2.35 46.15 5.14
1077 1126 1.302366 TCACATCCATGCGCTCATTC 58.698 50.000 9.73 0.00 0.00 2.67
1317 1366 3.869912 GCCCAACAGCTGAGTTCTTCATA 60.870 47.826 23.35 0.00 34.68 2.15
1337 1386 4.061596 GCACTTCCTCATATGTAAGAGCC 58.938 47.826 17.73 7.85 31.83 4.70
1382 1437 1.334869 CCACATAATCCTCGCAAAGCC 59.665 52.381 0.00 0.00 0.00 4.35
1414 1475 4.799419 GCATTTTGCTCAGCTTTTTGAA 57.201 36.364 0.00 0.00 40.96 2.69
1513 1574 0.463204 ACATCGGTGATCAGCTGGAG 59.537 55.000 21.73 11.54 0.00 3.86
1733 1859 0.537188 ACCCGACTAGCACAGAATGG 59.463 55.000 0.00 0.00 43.62 3.16
1952 2187 1.833630 GATGGACACTCACAGATCCCA 59.166 52.381 0.00 0.00 0.00 4.37
1972 2212 9.971744 GTTTATGGTATTTGCAAAGCTTTAATG 57.028 29.630 18.19 1.28 0.00 1.90
2219 2479 2.160853 GGGTTGGGTGGAAGGGAGT 61.161 63.158 0.00 0.00 0.00 3.85
2309 2575 1.958579 TCCGGTTCTCTCTGTTTCGAA 59.041 47.619 0.00 0.00 0.00 3.71
2499 2858 2.047274 CGGCGGGGCATATCGATT 60.047 61.111 1.71 0.00 0.00 3.34


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.