AutoCloner

Multiple sequence alignment - TraesCS4B01G395300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)

BLAST Results

Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

	qseqid	sseqid	percentage.identical	alignment.length	no.mismatch	no.gap.openings	qstart	qend	sstart	send	evalue	bitscore
0	TraesCS4B01G395300	chr4B	100.000	2597	0	0	1	2597	669558303	669560899	0.000000e+00	4796
1	TraesCS4B01G395300	chr4B	94.275	2620	88	27	1	2597	669471670	669474250	0.000000e+00	3951
2	TraesCS4B01G395300	chr4B	93.865	2608	96	27	1	2597	668513005	668515559	0.000000e+00	3871
3	TraesCS4B01G395300	chr4B	95.931	1794	61	6	1	1790	669342473	669340688	0.000000e+00	2898
4	TraesCS4B01G395300	chr4B	96.041	1667	59	4	1	1664	668649623	668651285	0.000000e+00	2706
5	TraesCS4B01G395300	chr4B	93.809	1793	88	12	1	1790	668972942	668974714	0.000000e+00	2675
6	TraesCS4B01G395300	chr4B	92.933	1797	81	19	1	1790	668587649	668589406	0.000000e+00	2573
7	TraesCS4B01G395300	chr4B	88.846	1542	93	35	254	1790	668445961	668447428	0.000000e+00	1821
8	TraesCS4B01G395300	chr4B	89.663	1335	47	19	558	1847	668402963	668404251	0.000000e+00	1616
9	TraesCS4B01G395300	chr4B	91.876	837	37	9	921	1733	666728693	666727864	0.000000e+00	1140
10	TraesCS4B01G395300	chr4B	92.773	761	35	7	1849	2597	668365371	668366123	0.000000e+00	1083
11	TraesCS4B01G395300	chr4B	92.470	757	27	17	1870	2597	668447558	668448313	0.000000e+00	1055
12	TraesCS4B01G395300	chr4B	91.938	769	32	17	1858	2597	669160673	669159906	0.000000e+00	1050
13	TraesCS4B01G395300	chr4B	91.927	768	32	16	1858	2597	669340560	669339795	0.000000e+00	1048
14	TraesCS4B01G395300	chr4B	90.561	784	35	20	1849	2597	668217626	668218405	0.000000e+00	1002
15	TraesCS4B01G395300	chr4B	87.949	863	81	14	930	1790	669161642	669160801	0.000000e+00	996
16	TraesCS4B01G395300	chr4B	82.690	907	83	33	961	1842	673413293	673412436	0.000000e+00	737
17	TraesCS4B01G395300	chr4B	88.811	572	33	17	2055	2597	668596199	668596768	0.000000e+00	673
18	TraesCS4B01G395300	chr4B	88.953	516	32	13	2104	2597	668451620	668452132	4.750000e-172	614
19	TraesCS4B01G395300	chr4B	95.513	312	14	0	1849	2160	668974833	668975144	1.390000e-137	499
20	TraesCS4B01G395300	chr4B	91.126	293	17	7	1861	2152	599587607	599587323	3.130000e-104	388
21	TraesCS4B01G395300	chr4B	87.983	233	10	6	2383	2597	668975388	668975620	2.560000e-65	259
22	TraesCS4B01G395300	chr5A	88.898	2450	128	57	1	2380	707848325	707850700	0.000000e+00	2885
23	TraesCS4B01G395300	chr5A	95.486	288	12	1	2311	2597	707850702	707850989	2.360000e-125	459
24	TraesCS4B01G395300	chrUn	100.000	746	0	0	1	746	346448733	346449478	0.000000e+00	1378
25	TraesCS4B01G395300	chrUn	100.000	746	0	0	1	746	348077199	348076454	0.000000e+00	1378
26	TraesCS4B01G395300	chrUn	84.426	1342	107	51	543	1847	79803866	79805142	0.000000e+00	1227
27	TraesCS4B01G395300	chrUn	86.872	975	68	19	909	1834	29364873	29363910	0.000000e+00	1037

These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

	query	scaffold	start	end	length	rev.comp	avg.bitscore	max.bitscore	avg.percent.identical	query.start	query.end	num_hsp	groupid	homo_length
0	TraesCS4B01G395300	chr4B	669558303	669560899	2596	False	4796.000000	4796	100.000000	1	2597	1	chr4B.!!$F9	2596
1	TraesCS4B01G395300	chr4B	669471670	669474250	2580	False	3951.000000	3951	94.275000	1	2597	1	chr4B.!!$F8	2596
2	TraesCS4B01G395300	chr4B	668513005	668515559	2554	False	3871.000000	3871	93.865000	1	2597	1	chr4B.!!$F4	2596
3	TraesCS4B01G395300	chr4B	668649623	668651285	1662	False	2706.000000	2706	96.041000	1	1664	1	chr4B.!!$F7	1663
4	TraesCS4B01G395300	chr4B	668587649	668589406	1757	False	2573.000000	2573	92.933000	1	1790	1	chr4B.!!$F5	1789
5	TraesCS4B01G395300	chr4B	669339795	669342473	2678	True	1973.000000	2898	93.929000	1	2597	2	chr4B.!!$R5	2596
6	TraesCS4B01G395300	chr4B	668402963	668404251	1288	False	1616.000000	1616	89.663000	558	1847	1	chr4B.!!$F3	1289
7	TraesCS4B01G395300	chr4B	668445961	668452132	6171	False	1163.333333	1821	90.089667	254	2597	3	chr4B.!!$F10	2343
8	TraesCS4B01G395300	chr4B	668972942	668975620	2678	False	1144.333333	2675	92.435000	1	2597	3	chr4B.!!$F11	2596
9	TraesCS4B01G395300	chr4B	666727864	666728693	829	True	1140.000000	1140	91.876000	921	1733	1	chr4B.!!$R2	812
10	TraesCS4B01G395300	chr4B	668365371	668366123	752	False	1083.000000	1083	92.773000	1849	2597	1	chr4B.!!$F2	748
11	TraesCS4B01G395300	chr4B	669159906	669161642	1736	True	1023.000000	1050	89.943500	930	2597	2	chr4B.!!$R4	1667
12	TraesCS4B01G395300	chr4B	668217626	668218405	779	False	1002.000000	1002	90.561000	1849	2597	1	chr4B.!!$F1	748
13	TraesCS4B01G395300	chr4B	673412436	673413293	857	True	737.000000	737	82.690000	961	1842	1	chr4B.!!$R3	881
14	TraesCS4B01G395300	chr4B	668596199	668596768	569	False	673.000000	673	88.811000	2055	2597	1	chr4B.!!$F6	542
15	TraesCS4B01G395300	chr5A	707848325	707850989	2664	False	1672.000000	2885	92.192000	1	2597	2	chr5A.!!$F1	2596
16	TraesCS4B01G395300	chrUn	346448733	346449478	745	False	1378.000000	1378	100.000000	1	746	1	chrUn.!!$F2	745
17	TraesCS4B01G395300	chrUn	348076454	348077199	745	True	1378.000000	1378	100.000000	1	746	1	chrUn.!!$R2	745
18	TraesCS4B01G395300	chrUn	79803866	79805142	1276	False	1227.000000	1227	84.426000	543	1847	1	chrUn.!!$F1	1304
19	TraesCS4B01G395300	chrUn	29363910	29364873	963	True	1037.000000	1037	86.872000	909	1834	1	chrUn.!!$R1	925

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
997	1046	1.442688	CTTCTTCGCCGCCAAAAGC	60.443	57.895	0.0	0.0	38.52	3.51	F

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
1952	2187	1.83363	GATGGACACTCACAGATCCCA	59.166	52.381	0.0	0.0	0.0	4.37	R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability
997	1046	1.442688	CTTCTTCGCCGCCAAAAGC	60.443	57.895	0.00	0.00	38.52	3.51
1002	1051	0.943359	TTCGCCGCCAAAAGCAAATG	60.943	50.000	0.00	0.00	44.04	2.32
1003	1052	1.372748	CGCCGCCAAAAGCAAATGA	60.373	52.632	0.00	0.00	44.04	2.57
1004	1053	1.616872	CGCCGCCAAAAGCAAATGAC	61.617	55.000	0.00	0.00	44.04	3.06
1077	1126	2.202987	GATGAGCTGGGCCACTCG	60.203	66.667	22.52	8.81	35.61	4.18
1317	1366	0.621862	CCCTGGAAGCCCTCCTACTT	60.622	60.000	0.00	0.00	45.64	2.24
1337	1386	4.999950	ACTTATGAAGAACTCAGCTGTTGG	59.000	41.667	14.67	7.99	37.52	3.77
1414	1475	4.079558	AGGATTATGTGGTCTCAGCCAAAT	60.080	41.667	0.00	0.00	40.68	2.32
1733	1859	3.558033	TCTTTGGTGGGTAGTGTTTTCC	58.442	45.455	0.00	0.00	0.00	3.13
1972	2212	1.833630	TGGGATCTGTGAGTGTCCATC	59.166	52.381	0.00	0.00	32.31	3.51
2172	2427	8.840200	ATAATCTCTACTCCTAAAGTTGGTCA	57.160	34.615	0.00	0.00	39.55	4.02
2254	2519	2.281208	CCTGGGCCGTCGAACAAA	60.281	61.111	0.00	0.00	0.00	2.83
2255	2520	1.894756	CCTGGGCCGTCGAACAAAA	60.895	57.895	0.00	0.00	0.00	2.44
2309	2575	3.182996	AAGGGGCCAAACCTCCGT	61.183	61.111	4.39	0.00	41.62	4.69
2499	2858	0.674581	CCTCTCACATCAAAGCCGCA	60.675	55.000	0.00	0.00	0.00	5.69
2569	2928	4.681978	GTTCACAGCCTCCGCCGT	62.682	66.667	0.00	0.00	34.57	5.68

Showing 1 to 16 of 16 entries

Previous1Next

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability
997	1046	4.840401	TTTCGTAGAGCATCGTCATTTG	57.160	40.909	0.00	0.00	42.67	2.32
1002	1051	2.789893	GTGGATTTCGTAGAGCATCGTC	59.210	50.000	0.00	0.00	42.67	4.20
1003	1052	2.427453	AGTGGATTTCGTAGAGCATCGT	59.573	45.455	0.00	0.00	42.67	3.73
1004	1053	3.046390	GAGTGGATTTCGTAGAGCATCG	58.954	50.000	0.00	0.00	42.67	3.84
1057	1106	4.864334	GTGGCCCAGCTCATCGGG	62.864	72.222	0.00	2.35	46.15	5.14
1077	1126	1.302366	TCACATCCATGCGCTCATTC	58.698	50.000	9.73	0.00	0.00	2.67
1317	1366	3.869912	GCCCAACAGCTGAGTTCTTCATA	60.870	47.826	23.35	0.00	34.68	2.15
1337	1386	4.061596	GCACTTCCTCATATGTAAGAGCC	58.938	47.826	17.73	7.85	31.83	4.70
1382	1437	1.334869	CCACATAATCCTCGCAAAGCC	59.665	52.381	0.00	0.00	0.00	4.35
1414	1475	4.799419	GCATTTTGCTCAGCTTTTTGAA	57.201	36.364	0.00	0.00	40.96	2.69
1513	1574	0.463204	ACATCGGTGATCAGCTGGAG	59.537	55.000	21.73	11.54	0.00	3.86
1733	1859	0.537188	ACCCGACTAGCACAGAATGG	59.463	55.000	0.00	0.00	43.62	3.16
1952	2187	1.833630	GATGGACACTCACAGATCCCA	59.166	52.381	0.00	0.00	0.00	4.37
1972	2212	9.971744	GTTTATGGTATTTGCAAAGCTTTAATG	57.028	29.630	18.19	1.28	0.00	1.90
2219	2479	2.160853	GGGTTGGGTGGAAGGGAGT	61.161	63.158	0.00	0.00	0.00	3.85
2309	2575	1.958579	TCCGGTTCTCTCTGTTTCGAA	59.041	47.619	0.00	0.00	0.00	3.71
2499	2858	2.047274	CGGCGGGGCATATCGATT	60.047	61.111	1.71	0.00	0.00	3.34

Showing 1 to 17 of 17 entries

Previous1Next

Based at the University of Bristol with support from BBSRC.

AutoCloner maintained by Alex Coulton.