Multiple sequence alignment - TraesCS4B01G395200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G395200 chr4B 100.000 2564 0 0 1 2564 669471684 669474247 0.000000e+00 4735
1 TraesCS4B01G395200 chr4B 97.508 2568 30 11 1 2564 668513019 668515556 0.000000e+00 4357
2 TraesCS4B01G395200 chr4B 94.237 2603 88 27 1 2564 669558317 669560896 0.000000e+00 3919
3 TraesCS4B01G395200 chr4B 97.607 1755 21 8 1 1751 668587663 668589400 0.000000e+00 2988
4 TraesCS4B01G395200 chr4B 94.366 1775 54 19 1 1751 668972956 668974708 0.000000e+00 2682
5 TraesCS4B01G395200 chr4B 91.933 1785 92 21 1 1752 669342459 669340694 0.000000e+00 2451
6 TraesCS4B01G395200 chr4B 92.067 1664 84 22 1 1631 668649637 668651285 0.000000e+00 2298
7 TraesCS4B01G395200 chr4B 90.678 1534 50 38 240 1752 668445961 668447422 0.000000e+00 1954
8 TraesCS4B01G395200 chr4B 85.056 1345 76 43 544 1819 668402963 668404251 0.000000e+00 1254
9 TraesCS4B01G395200 chr4B 90.909 902 39 15 886 1751 668216606 668217500 0.000000e+00 1171
10 TraesCS4B01G395200 chr4B 91.469 844 45 11 927 1751 669161642 669160807 0.000000e+00 1134
11 TraesCS4B01G395200 chr4B 93.634 754 34 7 1821 2564 668365371 668366120 0.000000e+00 1114
12 TraesCS4B01G395200 chr4B 92.680 765 26 11 1830 2564 669160673 669159909 0.000000e+00 1075
13 TraesCS4B01G395200 chr4B 92.838 754 22 13 1842 2564 668447558 668448310 0.000000e+00 1064
14 TraesCS4B01G395200 chr4B 92.418 765 26 13 1830 2564 669340560 669339798 0.000000e+00 1062
15 TraesCS4B01G395200 chr4B 90.525 781 33 17 1821 2564 668217626 668218402 0.000000e+00 994
16 TraesCS4B01G395200 chr4B 83.566 1144 84 33 652 1727 673297425 673296318 0.000000e+00 976
17 TraesCS4B01G395200 chr4B 86.428 921 72 26 775 1654 672926405 672927313 0.000000e+00 959
18 TraesCS4B01G395200 chr4B 89.613 568 28 12 2027 2564 668596199 668596765 0.000000e+00 693
19 TraesCS4B01G395200 chr4B 89.844 512 27 11 2076 2564 668451620 668452129 3.600000e-178 634
20 TraesCS4B01G395200 chr4B 96.154 312 12 0 1821 2132 668974833 668975144 6.330000e-141 510
21 TraesCS4B01G395200 chr4B 91.809 293 15 7 1833 2124 599587607 599587323 1.430000e-107 399
22 TraesCS4B01G395200 chr4B 88.696 230 8 6 2353 2564 668975388 668975617 5.440000e-67 265
23 TraesCS4B01G395200 chr5A 90.581 2081 84 35 1 2009 707848339 707850379 0.000000e+00 2654
24 TraesCS4B01G395200 chrUn 85.275 1365 93 34 539 1819 134396070 134394730 0.000000e+00 1308
25 TraesCS4B01G395200 chrUn 98.641 736 3 4 1 733 346448747 346449478 0.000000e+00 1297
26 TraesCS4B01G395200 chrUn 98.641 736 3 4 1 733 348077185 348076454 0.000000e+00 1297
27 TraesCS4B01G395200 chrUn 85.366 1353 82 29 539 1819 30530829 30529521 0.000000e+00 1295
28 TraesCS4B01G395200 chrUn 86.976 1144 88 25 529 1634 79803866 79804986 0.000000e+00 1230
29 TraesCS4B01G395200 chrUn 86.373 976 51 26 906 1819 29602423 29601468 0.000000e+00 990
30 TraesCS4B01G395200 chrUn 85.482 985 66 26 906 1820 29364873 29363896 0.000000e+00 955
31 TraesCS4B01G395200 chrUn 86.291 817 70 19 907 1689 99649764 99650572 0.000000e+00 850


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G395200 chr4B 669471684 669474247 2563 False 4735.000000 4735 100.0000 1 2564 1 chr4B.!!$F7 2563
1 TraesCS4B01G395200 chr4B 668513019 668515556 2537 False 4357.000000 4357 97.5080 1 2564 1 chr4B.!!$F3 2563
2 TraesCS4B01G395200 chr4B 669558317 669560896 2579 False 3919.000000 3919 94.2370 1 2564 1 chr4B.!!$F8 2563
3 TraesCS4B01G395200 chr4B 668587663 668589400 1737 False 2988.000000 2988 97.6070 1 1751 1 chr4B.!!$F4 1750
4 TraesCS4B01G395200 chr4B 668649637 668651285 1648 False 2298.000000 2298 92.0670 1 1631 1 chr4B.!!$F6 1630
5 TraesCS4B01G395200 chr4B 669339798 669342459 2661 True 1756.500000 2451 92.1755 1 2564 2 chr4B.!!$R4 2563
6 TraesCS4B01G395200 chr4B 668402963 668404251 1288 False 1254.000000 1254 85.0560 544 1819 1 chr4B.!!$F2 1275
7 TraesCS4B01G395200 chr4B 668445961 668452129 6168 False 1217.333333 1954 91.1200 240 2564 3 chr4B.!!$F11 2324
8 TraesCS4B01G395200 chr4B 668972956 668975617 2661 False 1152.333333 2682 93.0720 1 2564 3 chr4B.!!$F12 2563
9 TraesCS4B01G395200 chr4B 668365371 668366120 749 False 1114.000000 1114 93.6340 1821 2564 1 chr4B.!!$F1 743
10 TraesCS4B01G395200 chr4B 669159909 669161642 1733 True 1104.500000 1134 92.0745 927 2564 2 chr4B.!!$R3 1637
11 TraesCS4B01G395200 chr4B 668216606 668218402 1796 False 1082.500000 1171 90.7170 886 2564 2 chr4B.!!$F10 1678
12 TraesCS4B01G395200 chr4B 673296318 673297425 1107 True 976.000000 976 83.5660 652 1727 1 chr4B.!!$R2 1075
13 TraesCS4B01G395200 chr4B 672926405 672927313 908 False 959.000000 959 86.4280 775 1654 1 chr4B.!!$F9 879
14 TraesCS4B01G395200 chr4B 668596199 668596765 566 False 693.000000 693 89.6130 2027 2564 1 chr4B.!!$F5 537
15 TraesCS4B01G395200 chr5A 707848339 707850379 2040 False 2654.000000 2654 90.5810 1 2009 1 chr5A.!!$F1 2008
16 TraesCS4B01G395200 chrUn 134394730 134396070 1340 True 1308.000000 1308 85.2750 539 1819 1 chrUn.!!$R4 1280
17 TraesCS4B01G395200 chrUn 346448747 346449478 731 False 1297.000000 1297 98.6410 1 733 1 chrUn.!!$F3 732
18 TraesCS4B01G395200 chrUn 348076454 348077185 731 True 1297.000000 1297 98.6410 1 733 1 chrUn.!!$R5 732
19 TraesCS4B01G395200 chrUn 30529521 30530829 1308 True 1295.000000 1295 85.3660 539 1819 1 chrUn.!!$R3 1280
20 TraesCS4B01G395200 chrUn 79803866 79804986 1120 False 1230.000000 1230 86.9760 529 1634 1 chrUn.!!$F1 1105
21 TraesCS4B01G395200 chrUn 29601468 29602423 955 True 990.000000 990 86.3730 906 1819 1 chrUn.!!$R2 913
22 TraesCS4B01G395200 chrUn 29363896 29364873 977 True 955.000000 955 85.4820 906 1820 1 chrUn.!!$R1 914
23 TraesCS4B01G395200 chrUn 99649764 99650572 808 False 850.000000 850 86.2910 907 1689 1 chrUn.!!$F2 782

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
565 567 5.221244 GGTTTGGTTTTCTGTGCTCACTATT 60.221 40.0 1.47 0.0 0.0 1.73 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2209 2553 2.026522 TTTTTGTTCGACGGCCCTG 58.973 52.632 0.0 0.0 0.0 4.45 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
565 567 5.221244 GGTTTGGTTTTCTGTGCTCACTATT 60.221 40.000 1.47 0.00 0.00 1.73
623 625 7.084486 CCTGCTGTTTAGTTTATTGTTTCCTC 58.916 38.462 0.00 0.00 0.00 3.71
701 708 7.834881 AATACAATGAATGATGGCATCTCTT 57.165 32.000 26.49 19.38 32.35 2.85
1340 1417 2.820330 CTCAGCAGCTAAGCTCTTACC 58.180 52.381 0.00 0.00 44.54 2.85
1397 1492 1.474077 GCTTGCCGAGGATGTCAAAAT 59.526 47.619 0.00 0.00 0.00 1.82
2209 2553 3.391382 CGTCCTCCCTCACACCCC 61.391 72.222 0.00 0.00 0.00 4.95
2389 2746 1.134670 CGAGCGATTCCTCCTTCCTTT 60.135 52.381 0.00 0.00 0.00 3.11
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
623 625 4.277672 CCAGAATTAATGCCTCACCATCAG 59.722 45.833 0.00 0.00 0.00 2.90
745 753 7.235399 ACTCCATCACCCAAAACAGAAAAATAT 59.765 33.333 0.00 0.00 0.00 1.28
1340 1417 6.900568 CTTCCTTCAAGCACTTACTCATAG 57.099 41.667 0.00 0.00 0.00 2.23
1751 1989 7.111247 ACACAGAATGGATGTTTCTCAAAAA 57.889 32.000 0.00 0.00 43.62 1.94
1752 1990 6.713762 ACACAGAATGGATGTTTCTCAAAA 57.286 33.333 0.00 0.00 43.62 2.44
1753 1991 6.713762 AACACAGAATGGATGTTTCTCAAA 57.286 33.333 0.00 0.00 43.62 2.69
1754 1992 6.713762 AAACACAGAATGGATGTTTCTCAA 57.286 33.333 0.00 0.00 41.53 3.02
1755 1993 6.713762 AAAACACAGAATGGATGTTTCTCA 57.286 33.333 2.35 0.00 43.85 3.27
2018 2343 5.562298 AGGAAGTACTTCTTGCCAAACTA 57.438 39.130 29.66 0.00 43.95 2.24
2209 2553 2.026522 TTTTTGTTCGACGGCCCTG 58.973 52.632 0.00 0.00 0.00 4.45
2276 2627 2.159558 CGGTTCTCTCTGTTTCGATCGA 60.160 50.000 15.15 15.15 0.00 3.59
2389 2746 2.355837 GAGCGTGCGAGTGGTTCA 60.356 61.111 0.00 0.00 0.00 3.18
2443 2818 3.838271 GATGTGAGAGGGCGGCGA 61.838 66.667 12.98 0.00 0.00 5.54


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.