Multiple sequence alignment - TraesCS4B01G395100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G395100 chr4B 100.000 2594 0 0 1 2594 669342471 669339878 0.000000e+00 4791.0
1 TraesCS4B01G395100 chr4B 96.070 2214 74 8 1 2214 668972944 668975144 0.000000e+00 3594.0
2 TraesCS4B01G395100 chr4B 92.501 2347 95 35 252 2594 668445961 668448230 0.000000e+00 3284.0
3 TraesCS4B01G395100 chr4B 97.125 1774 25 3 1 1749 668649625 668651397 0.000000e+00 2970.0
4 TraesCS4B01G395100 chr4B 95.926 1792 61 6 1 1784 669558305 669560092 0.000000e+00 2894.0
5 TraesCS4B01G395100 chr4B 90.981 2018 126 27 1 2011 668587651 668589619 0.000000e+00 2667.0
6 TraesCS4B01G395100 chr4B 94.671 1670 72 13 928 2594 669161644 669159989 0.000000e+00 2575.0
7 TraesCS4B01G395100 chr4B 92.467 1792 95 19 1 1784 668513007 668514766 0.000000e+00 2525.0
8 TraesCS4B01G395100 chr4B 91.987 1797 92 21 1 1778 669471672 669473435 0.000000e+00 2473.0
9 TraesCS4B01G395100 chr4B 91.725 1728 106 18 889 2592 668216606 668218320 0.000000e+00 2364.0
10 TraesCS4B01G395100 chr4B 88.100 2084 118 54 541 2592 668364053 668366038 0.000000e+00 2355.0
11 TraesCS4B01G395100 chr4B 88.312 1463 79 21 556 1964 668402963 668404387 0.000000e+00 1670.0
12 TraesCS4B01G395100 chr4B 92.058 831 42 6 921 1727 666728693 666727863 0.000000e+00 1147.0
13 TraesCS4B01G395100 chr4B 86.524 935 76 31 773 1683 672926402 672927310 0.000000e+00 983.0
14 TraesCS4B01G395100 chr4B 91.499 694 27 13 1903 2594 669473504 669474167 0.000000e+00 926.0
15 TraesCS4B01G395100 chr4B 91.185 692 31 16 1903 2592 669560151 669560814 0.000000e+00 913.0
16 TraesCS4B01G395100 chr4B 90.173 692 25 16 1903 2592 668514824 668515474 0.000000e+00 861.0
17 TraesCS4B01G395100 chr4B 98.152 487 8 1 2109 2594 668596199 668596685 0.000000e+00 848.0
18 TraesCS4B01G395100 chr4B 95.205 438 12 3 2158 2594 668451620 668452049 0.000000e+00 684.0
19 TraesCS4B01G395100 chr4B 99.278 277 2 0 1837 2113 668589621 668589897 3.850000e-138 501.0
20 TraesCS4B01G395100 chr5A 89.601 1904 112 35 1 1853 707848327 707850195 0.000000e+00 2340.0
21 TraesCS4B01G395100 chrUn 100.000 744 0 0 1 744 346448735 346449478 0.000000e+00 1375.0
22 TraesCS4B01G395100 chrUn 100.000 744 0 0 1 744 348077197 348076454 0.000000e+00 1375.0
23 TraesCS4B01G395100 chrUn 86.821 1123 73 23 909 1964 29364873 29363759 0.000000e+00 1184.0
24 TraesCS4B01G395100 chrUn 83.042 1203 136 34 913 2070 100353103 100351924 0.000000e+00 1029.0
25 TraesCS4B01G395100 chrUn 86.400 875 84 16 909 1769 28897766 28898619 0.000000e+00 924.0
26 TraesCS4B01G395100 chrUn 92.553 188 12 2 1785 1970 79805102 79805289 4.250000e-68 268.0
27 TraesCS4B01G395100 chr1A 91.892 74 5 1 2511 2584 464245077 464245005 4.570000e-18 102.0
28 TraesCS4B01G395100 chr4A 89.189 74 7 1 2511 2584 624999949 624999877 9.890000e-15 91.6


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G395100 chr4B 669339878 669342471 2593 True 4791.0 4791 100.0000 1 2594 1 chr4B.!!$R3 2593
1 TraesCS4B01G395100 chr4B 668972944 668975144 2200 False 3594.0 3594 96.0700 1 2214 1 chr4B.!!$F6 2213
2 TraesCS4B01G395100 chr4B 668649625 668651397 1772 False 2970.0 2970 97.1250 1 1749 1 chr4B.!!$F5 1748
3 TraesCS4B01G395100 chr4B 669159989 669161644 1655 True 2575.0 2575 94.6710 928 2594 1 chr4B.!!$R2 1666
4 TraesCS4B01G395100 chr4B 668216606 668218320 1714 False 2364.0 2364 91.7250 889 2592 1 chr4B.!!$F1 1703
5 TraesCS4B01G395100 chr4B 668364053 668366038 1985 False 2355.0 2355 88.1000 541 2592 1 chr4B.!!$F2 2051
6 TraesCS4B01G395100 chr4B 668445961 668452049 6088 False 1984.0 3284 93.8530 252 2594 2 chr4B.!!$F8 2342
7 TraesCS4B01G395100 chr4B 669558305 669560814 2509 False 1903.5 2894 93.5555 1 2592 2 chr4B.!!$F12 2591
8 TraesCS4B01G395100 chr4B 669471672 669474167 2495 False 1699.5 2473 91.7430 1 2594 2 chr4B.!!$F11 2593
9 TraesCS4B01G395100 chr4B 668513007 668515474 2467 False 1693.0 2525 91.3200 1 2592 2 chr4B.!!$F9 2591
10 TraesCS4B01G395100 chr4B 668402963 668404387 1424 False 1670.0 1670 88.3120 556 1964 1 chr4B.!!$F3 1408
11 TraesCS4B01G395100 chr4B 668587651 668589897 2246 False 1584.0 2667 95.1295 1 2113 2 chr4B.!!$F10 2112
12 TraesCS4B01G395100 chr4B 666727863 666728693 830 True 1147.0 1147 92.0580 921 1727 1 chr4B.!!$R1 806
13 TraesCS4B01G395100 chr4B 672926402 672927310 908 False 983.0 983 86.5240 773 1683 1 chr4B.!!$F7 910
14 TraesCS4B01G395100 chr5A 707848327 707850195 1868 False 2340.0 2340 89.6010 1 1853 1 chr5A.!!$F1 1852
15 TraesCS4B01G395100 chrUn 346448735 346449478 743 False 1375.0 1375 100.0000 1 744 1 chrUn.!!$F3 743
16 TraesCS4B01G395100 chrUn 348076454 348077197 743 True 1375.0 1375 100.0000 1 744 1 chrUn.!!$R3 743
17 TraesCS4B01G395100 chrUn 29363759 29364873 1114 True 1184.0 1184 86.8210 909 1964 1 chrUn.!!$R1 1055
18 TraesCS4B01G395100 chrUn 100351924 100353103 1179 True 1029.0 1029 83.0420 913 2070 1 chrUn.!!$R2 1157
19 TraesCS4B01G395100 chrUn 28897766 28898619 853 False 924.0 924 86.4000 909 1769 1 chrUn.!!$F1 860

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1192 1282 4.175337 GGGTATGCCCGCAGCTGA 62.175 66.667 20.43 0.0 46.51 4.26 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2446 2852 1.657487 CTCGTATACCTGCGTGCGG 60.657 63.158 0.0 0.0 0.0 5.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1192 1282 4.175337 GGGTATGCCCGCAGCTGA 62.175 66.667 20.43 0.0 46.51 4.26
1221 1311 2.280797 GACGTGGCAGGCTTGTCA 60.281 61.111 0.00 0.0 36.36 3.58
1222 1312 1.672356 GACGTGGCAGGCTTGTCAT 60.672 57.895 6.34 0.0 41.71 3.06
1289 1379 2.200081 TCAGGAGGCTAAGCTGGAAAT 58.800 47.619 0.00 0.0 0.00 2.17
1381 1483 1.628846 AGGAAGACTTGGGCGTATTGT 59.371 47.619 0.00 0.0 0.00 2.71
1393 1495 2.538939 GGCGTATTGTTTTGCGAGGATC 60.539 50.000 0.00 0.0 0.00 3.36
1805 2014 3.914426 ACAGTCACATGGAGGTATTCC 57.086 47.619 0.00 0.0 46.98 3.01
2244 2641 3.069586 TCAGTTGGTCGTCTCTGTTCATT 59.930 43.478 0.00 0.0 0.00 2.57
2268 2665 5.131142 TGGTTAATTTTTGTCCCACCAACAT 59.869 36.000 0.00 0.0 29.78 2.71
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1125 1215 1.364171 GAGCGCATACGACTCCCAT 59.636 57.895 11.47 0.00 43.93 4.00
1221 1311 3.119352 GCTCGAGCTTTTGGATTTCCAAT 60.119 43.478 29.88 0.00 45.59 3.16
1222 1312 2.228822 GCTCGAGCTTTTGGATTTCCAA 59.771 45.455 29.88 7.96 45.10 3.53
1381 1483 2.237143 AGACCAGATGATCCTCGCAAAA 59.763 45.455 0.00 0.00 0.00 2.44
1393 1495 2.289882 TGACTTTGGCTGAGACCAGATG 60.290 50.000 0.00 0.00 43.02 2.90
1542 1644 6.019237 ACTCATCAGAATCATCGAAATGAACG 60.019 38.462 0.00 0.00 44.85 3.95
1805 2014 6.729690 TTGGCATATATTCCCAAAAAGAGG 57.270 37.500 10.71 0.00 35.80 3.69
2244 2641 4.469945 TGTTGGTGGGACAAAAATTAACCA 59.530 37.500 0.00 0.00 44.16 3.67
2446 2852 1.657487 CTCGTATACCTGCGTGCGG 60.657 63.158 0.00 0.00 0.00 5.69


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.