Multiple sequence alignment - TraesCS4B01G394900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G394900 chr4B 100.000 2303 0 0 1 2303 669142838 669140536 0 4253
1 TraesCS4B01G394900 chr4B 99.045 2304 17 4 1 2302 668991240 668993540 0 4128
2 TraesCS4B01G394900 chr4B 98.958 2304 20 2 1 2303 669304278 669301978 0 4119
3 TraesCS4B01G394900 chr4B 97.914 1534 28 4 772 2303 668229520 668231051 0 2652
4 TraesCS4B01G394900 chr4B 97.717 1533 31 2 772 2303 669485656 669487185 0 2634
5 TraesCS4B01G394900 chr4B 97.396 1536 31 6 772 2303 668907375 668908905 0 2606
6 TraesCS4B01G394900 chr4B 97.082 1542 31 7 772 2303 668465469 668467006 0 2586
7 TraesCS4B01G394900 chr4B 96.936 1534 36 7 772 2303 668526593 668528117 0 2562
8 TraesCS4B01G394900 chr4B 95.352 1549 32 15 772 2303 669589283 669590808 0 2425
9 TraesCS4B01G394900 chr4B 97.167 1200 26 5 1107 2303 668398706 668399900 0 2021
10 TraesCS4B01G394900 chr4B 97.552 776 15 3 1 772 668228289 668229064 0 1325
11 TraesCS4B01G394900 chr4B 97.548 775 14 3 1 772 669588063 669588835 0 1321
12 TraesCS4B01G394900 chr4B 97.419 775 16 3 1 772 668373860 668374633 0 1317
13 TraesCS4B01G394900 chr4B 97.172 778 15 4 1 772 668906143 668906919 0 1308
14 TraesCS4B01G394900 chr4B 97.169 777 15 5 1 772 668525363 668526137 0 1306
15 TraesCS4B01G394900 chr4B 97.154 773 18 4 1 772 668623211 668623980 0 1303
16 TraesCS4B01G394900 chr4B 96.907 776 18 5 1 772 669484426 669485199 0 1295
17 TraesCS4B01G394900 chr5A 97.406 771 15 5 1536 2303 707879183 707879951 0 1308
18 TraesCS4B01G394900 chr6D 96.613 561 17 2 772 1332 302034576 302034018 0 929


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G394900 chr4B 669140536 669142838 2302 True 4253.0 4253 100.0000 1 2303 1 chr4B.!!$R1 2302
1 TraesCS4B01G394900 chr4B 668991240 668993540 2300 False 4128.0 4128 99.0450 1 2302 1 chr4B.!!$F5 2301
2 TraesCS4B01G394900 chr4B 669301978 669304278 2300 True 4119.0 4119 98.9580 1 2303 1 chr4B.!!$R2 2302
3 TraesCS4B01G394900 chr4B 668465469 668467006 1537 False 2586.0 2586 97.0820 772 2303 1 chr4B.!!$F3 1531
4 TraesCS4B01G394900 chr4B 668398706 668399900 1194 False 2021.0 2021 97.1670 1107 2303 1 chr4B.!!$F2 1196
5 TraesCS4B01G394900 chr4B 668228289 668231051 2762 False 1988.5 2652 97.7330 1 2303 2 chr4B.!!$F6 2302
6 TraesCS4B01G394900 chr4B 669484426 669487185 2759 False 1964.5 2634 97.3120 1 2303 2 chr4B.!!$F9 2302
7 TraesCS4B01G394900 chr4B 668906143 668908905 2762 False 1957.0 2606 97.2840 1 2303 2 chr4B.!!$F8 2302
8 TraesCS4B01G394900 chr4B 668525363 668528117 2754 False 1934.0 2562 97.0525 1 2303 2 chr4B.!!$F7 2302
9 TraesCS4B01G394900 chr4B 669588063 669590808 2745 False 1873.0 2425 96.4500 1 2303 2 chr4B.!!$F10 2302
10 TraesCS4B01G394900 chr4B 668373860 668374633 773 False 1317.0 1317 97.4190 1 772 1 chr4B.!!$F1 771
11 TraesCS4B01G394900 chr4B 668623211 668623980 769 False 1303.0 1303 97.1540 1 772 1 chr4B.!!$F4 771
12 TraesCS4B01G394900 chr5A 707879183 707879951 768 False 1308.0 1308 97.4060 1536 2303 1 chr5A.!!$F1 767
13 TraesCS4B01G394900 chr6D 302034018 302034576 558 True 929.0 929 96.6130 772 1332 1 chr6D.!!$R1 560

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
240 246 1.136695 GCATGGCGAATTTGGGATTCA 59.863 47.619 0.0 0.0 0.0 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1533 2461 8.603181 CATAAGACAGAAAACCAAACAAAAAGG 58.397 33.333 0.0 0.0 0.0 3.11 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
92 97 4.461081 GCCAAGGTATTTTGTACACATGGA 59.539 41.667 0.00 0.00 0.00 3.41
138 144 2.104111 TCACGACCCCATGGATAATCAC 59.896 50.000 15.22 0.00 34.81 3.06
240 246 1.136695 GCATGGCGAATTTGGGATTCA 59.863 47.619 0.00 0.00 0.00 2.57
484 490 3.689347 TCTGCTCCTTGTTTACATGCAT 58.311 40.909 0.00 0.00 0.00 3.96
1533 2461 2.103941 TGTTTCCTGGGCCAATTTTCAC 59.896 45.455 8.04 0.31 0.00 3.18
1770 2699 7.310664 AGCATTCTTTACACATCTTGAACATG 58.689 34.615 0.00 0.00 0.00 3.21
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
138 144 5.163864 GCCCTGTTTGAAAGACAAAAAGTTG 60.164 40.000 10.32 4.35 46.65 3.16
240 246 3.769300 GCCATGTGGAAAAGTAGGGAAAT 59.231 43.478 2.55 0.00 37.39 2.17
1533 2461 8.603181 CATAAGACAGAAAACCAAACAAAAAGG 58.397 33.333 0.00 0.00 0.00 3.11


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.