Multiple sequence alignment - TraesCS4B01G394800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G394800 chr4B 100.000 2201 0 0 1 2201 668972944 668975144 0.000000e+00 4065.0
1 TraesCS4B01G394800 chr4B 96.070 2214 74 8 1 2201 669342471 669340258 0.000000e+00 3594.0
2 TraesCS4B01G394800 chr4B 95.031 1952 31 25 252 2201 668445961 668447848 0.000000e+00 3007.0
3 TraesCS4B01G394800 chr4B 93.227 2008 87 24 1 1998 668587651 668589619 0.000000e+00 2909.0
4 TraesCS4B01G394800 chr4B 95.006 1782 56 16 1 1771 668513007 668514766 0.000000e+00 2767.0
5 TraesCS4B01G394800 chr4B 94.404 1787 54 19 1 1765 669471672 669473434 0.000000e+00 2704.0
6 TraesCS4B01G394800 chr4B 94.194 1774 65 10 1 1737 668649625 668651397 0.000000e+00 2671.0
7 TraesCS4B01G394800 chr4B 93.802 1791 88 12 1 1771 669558305 669560092 0.000000e+00 2671.0
8 TraesCS4B01G394800 chr4B 99.372 1274 8 0 928 2201 669161644 669160371 0.000000e+00 2309.0
9 TraesCS4B01G394800 chr4B 94.030 1340 52 10 889 2201 668216606 668217944 0.000000e+00 2006.0
10 TraesCS4B01G394800 chr4B 87.979 1697 103 37 541 2201 668364053 668365684 0.000000e+00 1910.0
11 TraesCS4B01G394800 chr4B 86.037 1461 103 30 556 1951 668402963 668404387 0.000000e+00 1474.0
12 TraesCS4B01G394800 chr4B 86.081 1207 97 27 544 1720 456362156 456363321 0.000000e+00 1232.0
13 TraesCS4B01G394800 chr4B 96.154 312 12 0 1890 2201 669473504 669473815 6.370000e-141 510.0
14 TraesCS4B01G394800 chr4B 95.833 312 13 0 1890 2201 668514824 668515135 2.970000e-139 505.0
15 TraesCS4B01G394800 chr4B 95.513 312 14 0 1890 2201 669560151 669560462 1.380000e-137 499.0
16 TraesCS4B01G394800 chr4B 98.195 277 5 0 1824 2100 668589621 668589897 3.860000e-133 484.0
17 TraesCS4B01G394800 chr4B 100.000 140 0 0 2443 2582 668975386 668975525 2.550000e-65 259.0
18 TraesCS4B01G394800 chr4B 98.551 138 2 0 2445 2582 669160138 669160001 7.140000e-61 244.0
19 TraesCS4B01G394800 chr4B 99.254 134 1 0 2449 2582 669340023 669339890 2.570000e-60 243.0
20 TraesCS4B01G394800 chr4B 97.826 138 3 0 2445 2582 668448081 668448218 3.320000e-59 239.0
21 TraesCS4B01G394800 chr4B 97.761 134 3 0 2449 2582 668596540 668596673 5.560000e-57 231.0
22 TraesCS4B01G394800 chr4B 96.377 138 5 0 2445 2582 668218173 668218310 7.190000e-56 228.0
23 TraesCS4B01G394800 chr4B 100.000 106 0 0 2096 2201 668596199 668596304 2.030000e-46 196.0
24 TraesCS4B01G394800 chr4B 92.029 138 4 1 2445 2582 668451907 668452037 1.220000e-43 187.0
25 TraesCS4B01G394800 chr4B 84.058 138 4 2 2445 2582 668365909 668366028 1.620000e-22 117.0
26 TraesCS4B01G394800 chr4B 83.942 137 4 7 2445 2581 668515345 668515463 5.840000e-22 115.0
27 TraesCS4B01G394800 chr4B 83.704 135 4 7 2445 2579 669560685 669560801 7.550000e-21 111.0
28 TraesCS4B01G394800 chr5A 91.394 1894 84 28 1 1840 707848327 707850195 0.000000e+00 2521.0
29 TraesCS4B01G394800 chr5A 83.942 137 4 6 2445 2581 707850775 707850893 5.840000e-22 115.0
30 TraesCS4B01G394800 chrUn 84.085 1596 104 31 551 2057 30530829 30529295 0.000000e+00 1402.0
31 TraesCS4B01G394800 chrUn 100.000 744 0 0 1 744 346448735 346449478 0.000000e+00 1375.0
32 TraesCS4B01G394800 chrUn 100.000 744 0 0 1 744 348077197 348076454 0.000000e+00 1375.0
33 TraesCS4B01G394800 chrUn 84.744 1193 121 27 913 2057 100353103 100351924 0.000000e+00 1138.0
34 TraesCS4B01G394800 chrUn 86.148 1119 75 20 909 1951 29364873 29363759 0.000000e+00 1134.0
35 TraesCS4B01G394800 chrUn 92.021 188 13 2 1772 1957 79805102 79805289 1.970000e-66 263.0
36 TraesCS4B01G394800 chr1A 94.030 67 3 1 2512 2578 464245076 464245011 1.630000e-17 100.0
37 TraesCS4B01G394800 chr4A 91.045 67 5 1 2512 2578 624999948 624999883 3.540000e-14 89.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G394800 chr4B 668972944 668975525 2581 False 2162.000000 4065 100.000000 1 2582 2 chr4B.!!$F10 2581
1 TraesCS4B01G394800 chr4B 668649625 668651397 1772 False 2671.000000 2671 94.194000 1 1737 1 chr4B.!!$F3 1736
2 TraesCS4B01G394800 chr4B 669339890 669342471 2581 True 1918.500000 3594 97.662000 1 2582 2 chr4B.!!$R2 2581
3 TraesCS4B01G394800 chr4B 668587651 668589897 2246 False 1696.500000 2909 95.711000 1 2100 2 chr4B.!!$F8 2099
4 TraesCS4B01G394800 chr4B 669471672 669473815 2143 False 1607.000000 2704 95.279000 1 2201 2 chr4B.!!$F11 2200
5 TraesCS4B01G394800 chr4B 668402963 668404387 1424 False 1474.000000 1474 86.037000 556 1951 1 chr4B.!!$F2 1395
6 TraesCS4B01G394800 chr4B 669160001 669161644 1643 True 1276.500000 2309 98.961500 928 2582 2 chr4B.!!$R1 1654
7 TraesCS4B01G394800 chr4B 456362156 456363321 1165 False 1232.000000 1232 86.081000 544 1720 1 chr4B.!!$F1 1176
8 TraesCS4B01G394800 chr4B 668445961 668452037 6076 False 1144.333333 3007 94.962000 252 2582 3 chr4B.!!$F6 2330
9 TraesCS4B01G394800 chr4B 668513007 668515463 2456 False 1129.000000 2767 91.593667 1 2581 3 chr4B.!!$F7 2580
10 TraesCS4B01G394800 chr4B 668216606 668218310 1704 False 1117.000000 2006 95.203500 889 2582 2 chr4B.!!$F4 1693
11 TraesCS4B01G394800 chr4B 669558305 669560801 2496 False 1093.666667 2671 91.006333 1 2579 3 chr4B.!!$F12 2578
12 TraesCS4B01G394800 chr4B 668364053 668366028 1975 False 1013.500000 1910 86.018500 541 2582 2 chr4B.!!$F5 2041
13 TraesCS4B01G394800 chr5A 707848327 707850893 2566 False 1318.000000 2521 87.668000 1 2581 2 chr5A.!!$F1 2580
14 TraesCS4B01G394800 chrUn 30529295 30530829 1534 True 1402.000000 1402 84.085000 551 2057 1 chrUn.!!$R2 1506
15 TraesCS4B01G394800 chrUn 346448735 346449478 743 False 1375.000000 1375 100.000000 1 744 1 chrUn.!!$F2 743
16 TraesCS4B01G394800 chrUn 348076454 348077197 743 True 1375.000000 1375 100.000000 1 744 1 chrUn.!!$R4 743
17 TraesCS4B01G394800 chrUn 100351924 100353103 1179 True 1138.000000 1138 84.744000 913 2057 1 chrUn.!!$R3 1144
18 TraesCS4B01G394800 chrUn 29363759 29364873 1114 True 1134.000000 1134 86.148000 909 1951 1 chrUn.!!$R1 1042

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1239 1346 2.029918 GTCGCTGGAAATCCAAAAGCTT 60.03 45.455 3.35 0.0 46.97 3.74 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2447 2956 1.226859 GCTCGTATACCTGCGTGCA 60.227 57.895 0.0 0.0 45.32 4.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1239 1346 2.029918 GTCGCTGGAAATCCAAAAGCTT 60.030 45.455 3.35 0.0 46.97 3.74
1711 1930 9.561069 AAATGATATGTATCTTGGGTAGTGTTC 57.439 33.333 2.08 0.0 33.88 3.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1239 1346 2.418368 GGGGTAACACATCATGCTCA 57.582 50.000 0.0 0.0 42.67 4.26
1711 1930 2.223688 CCCGACTAGCACAGAATGAGAG 60.224 54.545 0.0 0.0 39.69 3.20
1979 2389 5.753921 CACAGATCCCTCCGTTTCTAAATAC 59.246 44.000 0.0 0.0 0.00 1.89
2442 2883 2.605818 TCGTATACCTGCGTGCAATTTC 59.394 45.455 0.0 0.0 0.00 2.17
2447 2956 1.226859 GCTCGTATACCTGCGTGCA 60.227 57.895 0.0 0.0 45.32 4.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.