Multiple sequence alignment - TraesCS4B01G394600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G394600 chr4B 100.000 2894 0 0 1 2894 668870047 668872940 0 5345
1 TraesCS4B01G394600 chr7B 99.383 2108 13 0 787 2894 133704280 133706387 0 3821
2 TraesCS4B01G394600 chr7B 99.298 1568 11 0 1327 2894 720550067 720551634 0 2835
3 TraesCS4B01G394600 chr7B 99.307 1443 10 0 1452 2894 616407636 616406194 0 2610
4 TraesCS4B01G394600 chr7B 99.620 790 3 0 4 793 616409799 616409010 0 1443
5 TraesCS4B01G394600 chr5A 99.336 2108 13 1 787 2894 513705441 513703335 0 3814
6 TraesCS4B01G394600 chr5A 99.283 1814 13 0 1081 2894 335710918 335712731 0 3278
7 TraesCS4B01G394600 chr5A 99.241 790 6 0 4 793 513707229 513706440 0 1426
8 TraesCS4B01G394600 chr6A 99.288 2108 15 0 787 2894 3634086 3636193 0 3810
9 TraesCS4B01G394600 chr6A 99.748 793 2 0 1 793 3632440 3633232 0 1454
10 TraesCS4B01G394600 chr3A 99.584 1923 8 0 972 2894 12635322 12637244 0 3507
11 TraesCS4B01G394600 chr4A 99.283 1673 12 0 1222 2894 741026543 741028215 0 3024
12 TraesCS4B01G394600 chr4A 99.874 793 1 0 1 793 741025098 741025890 0 1459
13 TraesCS4B01G394600 chr2A 99.395 1322 8 0 1573 2894 750960501 750961822 0 2398
14 TraesCS4B01G394600 chr2A 99.369 793 5 0 1 793 750958381 750959173 0 1437
15 TraesCS4B01G394600 chr1A 87.771 1431 149 19 801 2221 576245764 576247178 0 1650
16 TraesCS4B01G394600 chr6B 87.701 1431 150 19 801 2221 480825768 480827182 0 1644
17 TraesCS4B01G394600 chr3B 99.874 793 1 0 1 793 770474444 770475236 0 1459
18 TraesCS4B01G394600 chr3B 99.748 793 2 0 1 793 809185340 809184548 0 1454
19 TraesCS4B01G394600 chr5B 99.369 793 5 0 1 793 484822472 484823264 0 1437
20 TraesCS4B01G394600 chr2B 98.991 793 8 0 1 793 573940165 573939373 0 1421


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G394600 chr4B 668870047 668872940 2893 False 5345.0 5345 100.0000 1 2894 1 chr4B.!!$F1 2893
1 TraesCS4B01G394600 chr7B 133704280 133706387 2107 False 3821.0 3821 99.3830 787 2894 1 chr7B.!!$F1 2107
2 TraesCS4B01G394600 chr7B 720550067 720551634 1567 False 2835.0 2835 99.2980 1327 2894 1 chr7B.!!$F2 1567
3 TraesCS4B01G394600 chr7B 616406194 616409799 3605 True 2026.5 2610 99.4635 4 2894 2 chr7B.!!$R1 2890
4 TraesCS4B01G394600 chr5A 335710918 335712731 1813 False 3278.0 3278 99.2830 1081 2894 1 chr5A.!!$F1 1813
5 TraesCS4B01G394600 chr5A 513703335 513707229 3894 True 2620.0 3814 99.2885 4 2894 2 chr5A.!!$R1 2890
6 TraesCS4B01G394600 chr6A 3632440 3636193 3753 False 2632.0 3810 99.5180 1 2894 2 chr6A.!!$F1 2893
7 TraesCS4B01G394600 chr3A 12635322 12637244 1922 False 3507.0 3507 99.5840 972 2894 1 chr3A.!!$F1 1922
8 TraesCS4B01G394600 chr4A 741025098 741028215 3117 False 2241.5 3024 99.5785 1 2894 2 chr4A.!!$F1 2893
9 TraesCS4B01G394600 chr2A 750958381 750961822 3441 False 1917.5 2398 99.3820 1 2894 2 chr2A.!!$F1 2893
10 TraesCS4B01G394600 chr1A 576245764 576247178 1414 False 1650.0 1650 87.7710 801 2221 1 chr1A.!!$F1 1420
11 TraesCS4B01G394600 chr6B 480825768 480827182 1414 False 1644.0 1644 87.7010 801 2221 1 chr6B.!!$F1 1420
12 TraesCS4B01G394600 chr3B 770474444 770475236 792 False 1459.0 1459 99.8740 1 793 1 chr3B.!!$F1 792
13 TraesCS4B01G394600 chr3B 809184548 809185340 792 True 1454.0 1454 99.7480 1 793 1 chr3B.!!$R1 792
14 TraesCS4B01G394600 chr5B 484822472 484823264 792 False 1437.0 1437 99.3690 1 793 1 chr5B.!!$F1 792
15 TraesCS4B01G394600 chr2B 573939373 573940165 792 True 1421.0 1421 98.9910 1 793 1 chr2B.!!$R1 792

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
890 1900 5.344066 CACTTCACTAACAGATGCGATAGT 58.656 41.667 0.0 0.0 39.35 2.12 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2320 4524 4.036144 GCTTCTTGATATCCTTTGCTCACC 59.964 45.833 0.0 0.0 0.0 4.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
890 1900 5.344066 CACTTCACTAACAGATGCGATAGT 58.656 41.667 0.0 0.0 39.35 2.12
904 1914 7.427895 CAGATGCGATAGTGAAGATATTAGACG 59.572 40.741 0.0 0.0 39.35 4.18
2320 4524 2.517959 TCTCCAAACCAGAAATGGCAG 58.482 47.619 0.0 0.0 34.13 4.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
704 705 2.940410 ACATGACAAAAGAACGACGGTT 59.060 40.909 0.00 0.00 39.63 4.44
890 1900 5.582550 CACTCACTGCGTCTAATATCTTCA 58.417 41.667 0.00 0.00 0.00 3.02
1250 2260 3.673809 CGTACAGAAACTAGCTTGTGGAC 59.326 47.826 8.06 8.06 31.56 4.02
2320 4524 4.036144 GCTTCTTGATATCCTTTGCTCACC 59.964 45.833 0.00 0.00 0.00 4.02
2699 4904 9.255304 CAGGAGAGATCTTATAAACTTTAGCAC 57.745 37.037 0.00 0.00 0.00 4.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.