Multiple sequence alignment - TraesCS4B01G394300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G394300 chr4B 100.000 2564 0 0 1 2564 668363519 668366082 0.000000e+00 4735.0
1 TraesCS4B01G394300 chr4B 88.252 2128 120 54 535 2564 669341931 669339836 0.000000e+00 2425.0
2 TraesCS4B01G394300 chr4B 87.187 2115 114 57 535 2564 668446230 668448272 0.000000e+00 2259.0
3 TraesCS4B01G394300 chr4B 89.441 1771 105 33 864 2564 668216606 668218364 0.000000e+00 2159.0
4 TraesCS4B01G394300 chr4B 89.641 1670 97 28 962 2564 669161607 669159947 0.000000e+00 2056.0
5 TraesCS4B01G394300 chr4B 87.979 1697 103 37 535 2166 668973484 668975144 0.000000e+00 1910.0
6 TraesCS4B01G394300 chr4B 86.189 1506 100 35 258 1702 456361863 456363321 0.000000e+00 1530.0
7 TraesCS4B01G394300 chr4B 85.857 1506 102 31 258 1709 456381372 456379924 0.000000e+00 1498.0
8 TraesCS4B01G394300 chr4B 87.620 1147 94 24 505 1633 599589011 599587895 0.000000e+00 1288.0
9 TraesCS4B01G394300 chr4B 86.424 1208 93 26 535 1706 668513547 668514719 0.000000e+00 1256.0
10 TraesCS4B01G394300 chr4B 86.054 1219 86 36 535 1706 669472212 669473393 0.000000e+00 1232.0
11 TraesCS4B01G394300 chr4B 87.431 1090 104 16 562 1633 599464347 599463273 0.000000e+00 1223.0
12 TraesCS4B01G394300 chr4B 93.575 716 32 7 1853 2564 669473504 669474209 0.000000e+00 1055.0
13 TraesCS4B01G394300 chr4B 92.778 720 32 7 1853 2564 669560151 669560858 0.000000e+00 1024.0
14 TraesCS4B01G394300 chr4B 83.811 1186 78 43 607 1709 673413692 673412538 0.000000e+00 1022.0
15 TraesCS4B01G394300 chr4B 92.426 713 35 10 1853 2564 668514824 668515518 0.000000e+00 1000.0
16 TraesCS4B01G394300 chr4B 83.214 1120 101 37 651 1709 673297428 673296335 0.000000e+00 946.0
17 TraesCS4B01G394300 chr4B 85.350 901 77 21 784 1653 672926434 672927310 0.000000e+00 881.0
18 TraesCS4B01G394300 chr4B 91.149 531 20 13 2059 2564 668596199 668596727 0.000000e+00 695.0
19 TraesCS4B01G394300 chr4B 91.158 475 21 12 2108 2564 668451620 668452091 2.170000e-175 625.0
20 TraesCS4B01G394300 chr4B 94.225 329 5 6 551 865 668216197 668216525 8.240000e-135 490.0
21 TraesCS4B01G394300 chr4B 98.556 277 4 0 1787 2063 668589621 668589897 8.240000e-135 490.0
22 TraesCS4B01G394300 chr4B 86.093 453 18 14 1734 2158 599463108 599462673 1.810000e-121 446.0
23 TraesCS4B01G394300 chr4B 91.139 316 15 6 1 304 668445693 668446007 1.420000e-112 416.0
24 TraesCS4B01G394300 chr4B 94.964 139 6 1 331 468 668446075 668446213 1.540000e-52 217.0
25 TraesCS4B01G394300 chr4B 94.964 139 6 1 331 468 668513372 668513510 1.540000e-52 217.0
26 TraesCS4B01G394300 chr4B 94.964 139 6 1 331 468 668588016 668588154 1.540000e-52 217.0
27 TraesCS4B01G394300 chr4B 93.243 148 4 3 331 477 599465663 599465521 2.000000e-51 213.0
28 TraesCS4B01G394300 chr4B 91.216 148 3 5 162 304 673297699 673297557 2.600000e-45 193.0
29 TraesCS4B01G394300 chr4B 88.415 164 5 6 54 203 672926233 672926396 4.360000e-43 185.0
30 TraesCS4B01G394300 chr4B 100.000 47 0 0 258 304 668513257 668513303 1.260000e-13 87.9
31 TraesCS4B01G394300 chr4B 100.000 45 0 0 1 45 668216107 668216151 1.630000e-12 84.2
32 TraesCS4B01G394300 chr4B 100.000 45 0 0 1 45 668402873 668402917 1.630000e-12 84.2
33 TraesCS4B01G394300 chr4B 100.000 43 0 0 196 238 668216148 668216190 2.110000e-11 80.5
34 TraesCS4B01G394300 chr4B 100.000 43 0 0 196 238 668402914 668402956 2.110000e-11 80.5
35 TraesCS4B01G394300 chr6D 88.569 1426 72 17 331 1706 1069738 1071122 0.000000e+00 1646.0
36 TraesCS4B01G394300 chr6D 90.833 240 8 7 12 238 1069161 1069399 2.480000e-80 309.0
37 TraesCS4B01G394300 chr6D 100.000 47 0 0 258 304 1069631 1069677 1.260000e-13 87.9
38 TraesCS4B01G394300 chrUn 88.783 1364 55 17 331 1633 30531054 30529728 0.000000e+00 1581.0
39 TraesCS4B01G394300 chrUn 87.104 1357 92 19 331 1634 79803660 79804986 0.000000e+00 1459.0
40 TraesCS4B01G394300 chrUn 86.284 1378 90 26 331 1633 134396295 134394942 0.000000e+00 1406.0
41 TraesCS4B01G394300 chrUn 90.120 830 66 7 884 1706 28897766 28898586 0.000000e+00 1064.0
42 TraesCS4B01G394300 chrUn 82.504 1206 118 34 885 2020 100353106 100351924 0.000000e+00 972.0
43 TraesCS4B01G394300 chrUn 90.833 240 8 7 12 238 79803083 79803321 2.480000e-80 309.0
44 TraesCS4B01G394300 chrUn 91.064 235 7 6 17 238 30531631 30531398 3.210000e-79 305.0
45 TraesCS4B01G394300 chrUn 92.553 188 13 1 1734 1920 79805102 79805289 4.210000e-68 268.0
46 TraesCS4B01G394300 chrUn 89.888 178 2 5 43 208 99649320 99649493 5.560000e-52 215.0
47 TraesCS4B01G394300 chrUn 94.853 136 6 1 331 465 346449100 346449235 7.190000e-51 211.0
48 TraesCS4B01G394300 chrUn 89.888 89 9 0 2157 2245 34380688 34380600 5.800000e-22 115.0
49 TraesCS4B01G394300 chrUn 100.000 47 0 0 258 304 79803553 79803599 1.260000e-13 87.9
50 TraesCS4B01G394300 chrUn 100.000 47 0 0 258 304 346448986 346449032 1.260000e-13 87.9
51 TraesCS4B01G394300 chrUn 100.000 47 0 0 258 304 348076946 348076900 1.260000e-13 87.9
52 TraesCS4B01G394300 chr5A 84.604 1364 118 37 330 1633 709530294 709531625 0.000000e+00 1271.0
53 TraesCS4B01G394300 chr5A 86.127 1211 111 30 535 1706 707848863 707850055 0.000000e+00 1253.0
54 TraesCS4B01G394300 chr5A 84.103 1365 89 36 535 1803 707983758 707985090 0.000000e+00 1201.0
55 TraesCS4B01G394300 chr5A 85.228 1117 96 33 645 1706 707578379 707579481 0.000000e+00 1085.0
56 TraesCS4B01G394300 chr5A 91.093 247 12 6 1 238 684312304 684312549 2.460000e-85 326.0
57 TraesCS4B01G394300 chr5A 89.157 249 15 6 1 238 707983007 707983254 1.490000e-77 300.0
58 TraesCS4B01G394300 chr5A 95.683 139 5 1 331 468 707848688 707848826 3.320000e-54 222.0
59 TraesCS4B01G394300 chr5A 95.683 139 5 1 331 468 707983583 707983721 3.320000e-54 222.0
60 TraesCS4B01G394300 chr5A 84.699 183 7 8 29 207 707848183 707848348 2.040000e-36 163.0
61 TraesCS4B01G394300 chr1A 90.909 66 6 0 2447 2512 464245070 464245005 3.510000e-14 89.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G394300 chr4B 668363519 668366082 2563 False 4735.000000 4735 100.000000 1 2564 1 chr4B.!!$F2 2563
1 TraesCS4B01G394300 chr4B 669339836 669341931 2095 True 2425.000000 2425 88.252000 535 2564 1 chr4B.!!$R4 2029
2 TraesCS4B01G394300 chr4B 669159947 669161607 1660 True 2056.000000 2056 89.641000 962 2564 1 chr4B.!!$R3 1602
3 TraesCS4B01G394300 chr4B 668973484 668975144 1660 False 1910.000000 1910 87.979000 535 2166 1 chr4B.!!$F4 1631
4 TraesCS4B01G394300 chr4B 456361863 456363321 1458 False 1530.000000 1530 86.189000 258 1702 1 chr4B.!!$F1 1444
5 TraesCS4B01G394300 chr4B 456379924 456381372 1448 True 1498.000000 1498 85.857000 258 1709 1 chr4B.!!$R1 1451
6 TraesCS4B01G394300 chr4B 599587895 599589011 1116 True 1288.000000 1288 87.620000 505 1633 1 chr4B.!!$R2 1128
7 TraesCS4B01G394300 chr4B 669472212 669474209 1997 False 1143.500000 1232 89.814500 535 2564 2 chr4B.!!$F11 2029
8 TraesCS4B01G394300 chr4B 669560151 669560858 707 False 1024.000000 1024 92.778000 1853 2564 1 chr4B.!!$F5 711
9 TraesCS4B01G394300 chr4B 673412538 673413692 1154 True 1022.000000 1022 83.811000 607 1709 1 chr4B.!!$R5 1102
10 TraesCS4B01G394300 chr4B 668445693 668452091 6398 False 879.250000 2259 91.112000 1 2564 4 chr4B.!!$F8 2563
11 TraesCS4B01G394300 chr4B 668216107 668218364 2257 False 703.425000 2159 95.916500 1 2564 4 chr4B.!!$F6 2563
12 TraesCS4B01G394300 chr4B 668596199 668596727 528 False 695.000000 695 91.149000 2059 2564 1 chr4B.!!$F3 505
13 TraesCS4B01G394300 chr4B 668513257 668515518 2261 False 640.225000 1256 93.453500 258 2564 4 chr4B.!!$F9 2306
14 TraesCS4B01G394300 chr4B 599462673 599465663 2990 True 627.333333 1223 88.922333 331 2158 3 chr4B.!!$R6 1827
15 TraesCS4B01G394300 chr4B 673296335 673297699 1364 True 569.500000 946 87.215000 162 1709 2 chr4B.!!$R7 1547
16 TraesCS4B01G394300 chr4B 672926233 672927310 1077 False 533.000000 881 86.882500 54 1653 2 chr4B.!!$F12 1599
17 TraesCS4B01G394300 chr4B 668588016 668589897 1881 False 353.500000 490 96.760000 331 2063 2 chr4B.!!$F10 1732
18 TraesCS4B01G394300 chr6D 1069161 1071122 1961 False 680.966667 1646 93.134000 12 1706 3 chr6D.!!$F1 1694
19 TraesCS4B01G394300 chrUn 134394942 134396295 1353 True 1406.000000 1406 86.284000 331 1633 1 chrUn.!!$R3 1302
20 TraesCS4B01G394300 chrUn 28897766 28898586 820 False 1064.000000 1064 90.120000 884 1706 1 chrUn.!!$F1 822
21 TraesCS4B01G394300 chrUn 100351924 100353106 1182 True 972.000000 972 82.504000 885 2020 1 chrUn.!!$R2 1135
22 TraesCS4B01G394300 chrUn 30529728 30531631 1903 True 943.000000 1581 89.923500 17 1633 2 chrUn.!!$R5 1616
23 TraesCS4B01G394300 chrUn 79803083 79805289 2206 False 530.975000 1459 92.622500 12 1920 4 chrUn.!!$F3 1908
24 TraesCS4B01G394300 chr5A 709530294 709531625 1331 False 1271.000000 1271 84.604000 330 1633 1 chr5A.!!$F3 1303
25 TraesCS4B01G394300 chr5A 707578379 707579481 1102 False 1085.000000 1085 85.228000 645 1706 1 chr5A.!!$F2 1061
26 TraesCS4B01G394300 chr5A 707983007 707985090 2083 False 574.333333 1201 89.647667 1 1803 3 chr5A.!!$F5 1802
27 TraesCS4B01G394300 chr5A 707848183 707850055 1872 False 546.000000 1253 88.836333 29 1706 3 chr5A.!!$F4 1677

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
960 2579 1.003118 CCAGGTAGCAGCAACCAACTA 59.997 52.381 0.0 0.0 39.64 2.24 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2293 4388 0.264657 AGGTTTGGCCCCTTGACTTT 59.735 50.0 0.0 0.0 38.26 2.66 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
960 2579 1.003118 CCAGGTAGCAGCAACCAACTA 59.997 52.381 0.00 0.00 39.64 2.24
1368 3014 2.092375 GTGCTATAAGGAAGCCTTGGGT 60.092 50.000 8.91 0.00 44.44 4.51
1370 3016 3.391296 TGCTATAAGGAAGCCTTGGGTAG 59.609 47.826 8.91 9.03 44.44 3.18
1492 3174 4.363990 CGCGTCTCCTGGTGCTGT 62.364 66.667 0.00 0.00 0.00 4.40
1498 3180 2.525629 TCCTGGTGCTGTTCCGGA 60.526 61.111 0.00 0.00 33.49 5.14
1544 3244 2.878406 CGGTTTGTTTCTGTGATCCTGT 59.122 45.455 0.00 0.00 0.00 4.00
1605 3333 6.006449 AGGCTGTTGTGATGAGTATTTCTTT 58.994 36.000 0.00 0.00 0.00 2.52
1717 3511 7.715265 TTCTCATTCTGTGTTACTTTCAGTC 57.285 36.000 0.00 0.00 0.00 3.51
1897 3941 6.320672 AGAATGTGGATGGATTCACTCATTTC 59.679 38.462 0.00 0.00 35.15 2.17
2075 4147 2.897350 TGGCAAGTAGTACTTCCTCCA 58.103 47.619 21.82 19.85 36.03 3.86
2195 4274 2.295349 TCAGTTGGTAGTCTCCGTTCAC 59.705 50.000 0.00 0.00 0.00 3.18
2293 4388 1.531748 GCTTAGCTATGCCCCCACA 59.468 57.895 18.46 0.00 0.00 4.17
2444 4539 3.036084 CGAACCACTCGCACGCTT 61.036 61.111 0.00 0.00 41.49 4.68
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
94 101 4.935702 GGTGTTACCAAACAAACCCTAAC 58.064 43.478 0.00 0.00 46.84 2.34
167 190 2.632512 CCACAACCAAGCAAACCCTAAT 59.367 45.455 0.00 0.00 0.00 1.73
842 2334 4.773323 AGTTAGGACAGCAGCAAATTTC 57.227 40.909 0.00 0.00 0.00 2.17
1048 2670 4.783621 GCCCAGCTCATCGGTGCA 62.784 66.667 0.00 0.00 39.77 4.57
1368 3014 3.386078 GTGAGACCAGATCCTGCAATCTA 59.614 47.826 0.56 0.00 34.21 1.98
1370 3016 2.559440 GTGAGACCAGATCCTGCAATC 58.441 52.381 0.00 0.00 0.00 2.67
1492 3174 2.507886 ACATAATGGTGACCATCCGGAA 59.492 45.455 18.84 1.96 44.40 4.30
1605 3333 4.514585 ACTGTTTGCCACGCCCCA 62.515 61.111 0.00 0.00 0.00 4.96
1680 3448 5.531287 ACAGAATGAGAAAACACTACCCAAC 59.469 40.000 0.00 0.00 39.69 3.77
1897 3941 7.956403 CACTAGTAGAAAACTATATACGGAGCG 59.044 40.741 3.59 0.00 39.96 5.03
2043 4115 2.061509 ACTTGCCAAACCGGTTAGTT 57.938 45.000 22.60 1.22 36.97 2.24
2195 4274 1.469703 GGTGGGACGAAAATTAACCGG 59.530 52.381 0.00 0.00 0.00 5.28
2290 4385 1.118838 TTTGGCCCCTTGACTTTGTG 58.881 50.000 0.00 0.00 0.00 3.33
2293 4388 0.264657 AGGTTTGGCCCCTTGACTTT 59.735 50.000 0.00 0.00 38.26 2.66
2444 4539 3.717294 GGGCGAAGGGAAGGAGCA 61.717 66.667 0.00 0.00 0.00 4.26


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.